ID: 981990997

View in Genome Browser
Species Human (GRCh38)
Location 4:150920975-150920997
Sequence GAAAATGCCCAGTCACAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 6, 3: 20, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981990997 Original CRISPR GAAAATGCCCAGTCACAGCT TGG (reversed) Intronic
900606937 1:3527929-3527951 GAAAATGCACAGGCCCAGGTCGG + Intronic
900786192 1:4652257-4652279 GGAAATGCCAAGTCTCAGTTAGG - Intergenic
901599050 1:10408126-10408148 GAACTTGCCCAGTCACAGCAGGG - Exonic
903335259 1:22620287-22620309 GAAGATGCCCACACACACCTGGG + Intergenic
907447996 1:54521638-54521660 TAAATTACCCAGTCTCAGCTGGG - Intergenic
907963850 1:59310044-59310066 GACAATGCCAAGTCACAGATGGG - Intronic
908645584 1:66274466-66274488 TAAAATGCCCATTTTCAGCTGGG - Intronic
911631195 1:100185465-100185487 GAAATTGTCCAGTCTCGGCTGGG - Intergenic
911660821 1:100499443-100499465 GTAAACGCCAAGTCACAACTGGG + Exonic
912206572 1:107515817-107515839 GACAATGGCCAGTCACTGCAGGG - Intergenic
912956769 1:114159457-114159479 GAAAAGGCCCTGTCAAAACTAGG + Intergenic
915228620 1:154429413-154429435 GCAAGTGCACAGTCCCAGCTGGG - Exonic
915280819 1:154820968-154820990 GAAAATGCCGAGTAACAAATGGG + Intronic
917380345 1:174399616-174399638 TAAATTGCCCAGTCTCAGGTAGG - Intronic
921610556 1:217207627-217207649 TAAAATGCTCAGTCTCAGGTAGG + Intergenic
921925325 1:220706217-220706239 GAAGATGCCCAGATTCAGCTAGG - Intergenic
922184428 1:223261420-223261442 TAACTTGCTCAGTCACAGCTAGG - Intronic
924189678 1:241537615-241537637 TAAATTGCCCAGTCTCAGGTAGG - Intronic
1063310588 10:4948467-4948489 GAAATTGCCCTGCCCCAGCTTGG - Intronic
1063495809 10:6506797-6506819 GAAAATCCTAAGTCACAGCATGG - Intronic
1063954108 10:11250159-11250181 GAAAATTCCAAGTCATAGCATGG + Intronic
1066304354 10:34125549-34125571 GAAATTGCCCAGGCACAGGGAGG + Intronic
1066612043 10:37259361-37259383 GATAATGCCAAGTGACAGCAAGG + Intronic
1066805659 10:39249919-39249941 CAAAATGTCCAGTCACAGAATGG + Intergenic
1067428519 10:46226983-46227005 GACAGTGCCCAGTCCCCGCTAGG - Intergenic
1069648183 10:70020018-70020040 GACAATCCCCAGTACCAGCTTGG + Intergenic
1073916412 10:108409632-108409654 GCAAATGCCCAGTTATAACTTGG + Intergenic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1075139353 10:119817980-119818002 GGAAATGCGCAGTCCCAGCAGGG + Intronic
1075734074 10:124653426-124653448 GAAAATACCCAGGCACTGCCAGG + Intronic
1079713013 11:23709588-23709610 GAAAATACACAGTCAGGGCTGGG + Intergenic
1082297555 11:50460785-50460807 CCAAATGCCCAGTCACAGAATGG - Intergenic
1082310858 11:50646538-50646560 CAAAATGCCCATTCACAGAATGG - Intergenic
1082878483 11:58013990-58014012 TAAATTACCCAGTCACAGATAGG - Intergenic
1084027650 11:66462349-66462371 GAAAATTCCCAGCCTCAGCCAGG + Intronic
1086015770 11:82165768-82165790 CAAAATGACAAGTCATAGCTTGG - Intergenic
1086949830 11:92880545-92880567 AAAAATGCCAAGTTACAGTTGGG - Intronic
1087003775 11:93448038-93448060 GAAAATGACAAGTCACAGACTGG - Intergenic
1088134908 11:106543496-106543518 TAAATTGCCCAGTCACAGCATGG + Intergenic
1090334488 11:125953574-125953596 GTAGATGCCCAGGCGCAGCTGGG - Intergenic
1090649616 11:128794729-128794751 GAAAAAGCCCACTCACAACCTGG - Intronic
1091101850 11:132881766-132881788 GCAACTGCGCAGTCACAGTTGGG - Intronic
1091273559 11:134334159-134334181 AACACTGCCCAGTAACAGCTGGG - Intronic
1091407230 12:216686-216708 GAAACAGCCCAGTCTCAGCTAGG - Intergenic
1095415145 12:41968344-41968366 TAAAAGGCCTAGTCACAGCGGGG - Intergenic
1097008021 12:55932497-55932519 GAAACTTCCCAGTGACAGGTGGG - Intronic
1097985125 12:65775007-65775029 GAAAATAACCAGTCATATCTGGG + Intergenic
1098982619 12:76973863-76973885 GAAAACCCCCAGTACCAGCTAGG - Intergenic
1103118355 12:118357708-118357730 GAAATATCCCAGTCATAGCTTGG - Intronic
1103236920 12:119381076-119381098 GAATATGCCCAGTGACAGGGAGG + Intronic
1103878011 12:124143894-124143916 GCAAATACCCATTAACAGCTTGG - Intronic
1104719968 12:131039756-131039778 GAAAGGGCCCAGACTCAGCTGGG + Intronic
1105028723 12:132868194-132868216 GAAAGAGCCCAGTCACGGCTGGG + Intronic
1106523873 13:30522686-30522708 GAAAAGGCTCAGTTATAGCTTGG + Intronic
1107140451 13:36993012-36993034 GAAGATGCACAGCCTCAGCTGGG + Intronic
1107843825 13:44489920-44489942 GAACATTCACAGACACAGCTAGG + Intronic
1113411232 13:110091917-110091939 GATAATACCAAGTCCCAGCTAGG - Intergenic
1117639897 14:57786601-57786623 GACAATGCCCAGTACCAGCCCGG + Intronic
1117881559 14:60317813-60317835 GCAAATTACCATTCACAGCTTGG + Intergenic
1118340034 14:64887756-64887778 ACAAATGCCCACTCACAGTTTGG - Intergenic
1120537530 14:85715362-85715384 GACAATGCCCAGTACCAGCTAGG - Intergenic
1120622100 14:86776432-86776454 TAAATTGCCCAGTCTCAGGTAGG + Intergenic
1121455497 14:94036237-94036259 GAAAAAGGCCAGTTACAACTGGG + Intronic
1121682837 14:95808498-95808520 GAATATGCCCTGTCGCAGCCAGG - Intergenic
1122308937 14:100782696-100782718 GAAATGGCCCAGTTGCAGCTGGG + Intergenic
1124687873 15:31797862-31797884 AAAAATGCCCAAAAACAGCTGGG + Intronic
1124943350 15:34239077-34239099 GGAAATGCCCTCTCTCAGCTTGG + Exonic
1124967877 15:34450973-34450995 GAAAATGTTCAGTGAAAGCTTGG + Intergenic
1126209894 15:46089889-46089911 GCAAATTCCCATTCACAGCCTGG - Intergenic
1127288298 15:57549210-57549232 GGCCAGGCCCAGTCACAGCTGGG + Exonic
1128781582 15:70362151-70362173 GAAAGTGCTCTGTAACAGCTGGG - Intergenic
1131546430 15:93319619-93319641 GAAAAGGCCCAGTCACGGCTAGG - Intergenic
1139101792 16:63776521-63776543 CAAAATGGCAAGCCACAGCTTGG + Intergenic
1139970115 16:70769109-70769131 AAAAATGCACATCCACAGCTGGG - Intronic
1143784526 17:9246711-9246733 GAAAAAGCCCAATCCCAGCCAGG + Intergenic
1143925787 17:10368662-10368684 GAAAATGGCAAATAACAGCTGGG + Intronic
1144455682 17:15416524-15416546 GAAAACCCCCAGGTACAGCTTGG - Intergenic
1144677555 17:17171599-17171621 GTGAATGCCCAGTCACAGCTGGG + Intronic
1146535574 17:33647775-33647797 GAAAATGCCCAATTAGAGCAGGG + Intronic
1147906280 17:43825192-43825214 GAAAAGCCCCAATCATAGCTTGG - Intronic
1149805376 17:59612674-59612696 GAAAATGATTAGTCACAGCTGGG + Intergenic
1151436197 17:74099325-74099347 GAAAATGCCCAGGGAAAGCAAGG + Intergenic
1152173091 17:78766850-78766872 GAAAAAGCCCATTCAAAGCATGG + Intronic
1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG + Intergenic
1154938550 18:21087560-21087582 GAAAATGGCCAGGCACAGAATGG + Intronic
1154960589 18:21304797-21304819 GAAAATGCTCATTCCCACCTAGG + Intronic
1158271578 18:55722048-55722070 GAAAATGCTCAAACTCAGCTGGG - Intergenic
1159607389 18:70488985-70489007 GAAAATGCCTAGACATGGCTGGG + Intergenic
1160130227 18:76218781-76218803 GAAACTGTCCAAACACAGCTAGG - Intergenic
1161846574 19:6714520-6714542 GAGAATGTCCAGACACAGGTCGG - Intronic
1163856193 19:19704191-19704213 TAAAATACACAGCCACAGCTAGG + Intergenic
1164366084 19:27583331-27583353 CAAAATGTCCATTCACAGATTGG - Intergenic
1167179902 19:47894965-47894987 CAACATGCCCAGCCACAGCTGGG - Intergenic
1168707847 19:58479953-58479975 GCACAGGCCCAGTCAGAGCTGGG + Exonic
930203555 2:48566577-48566599 TAAAATGCCCAGTCACAGGTCGG - Intronic
930378532 2:50597841-50597863 TAAAATGCCCATTCCCAGCGGGG + Intronic
930441219 2:51409212-51409234 GAAAAAGCCCAGTGTCAGCAAGG + Intergenic
934492268 2:94769491-94769513 AAAGATGCACAGGCACAGCTTGG - Intergenic
935586304 2:104802794-104802816 GAAAATGCCAAGCCACATCAGGG - Intergenic
936387213 2:112041149-112041171 AAAGGTCCCCAGTCACAGCTTGG + Intergenic
937009322 2:118548014-118548036 CAAAATGCACATTCACAGGTGGG - Intergenic
937037701 2:118795498-118795520 TAAAATGGCCAGGCACAACTTGG - Intergenic
937929554 2:127193520-127193542 GGAAGTGGCCAGTCACCGCTGGG - Intronic
938811706 2:134860000-134860022 GAAAAGGCACAGTAACAGTTTGG + Intronic
939963917 2:148592199-148592221 CAATATGCACAGTCCCAGCTAGG + Intergenic
941917135 2:170820262-170820284 GCAAATGCCAAGTCACCGGTAGG + Intronic
944389459 2:199202434-199202456 AAAAATGCCCAATCAATGCTTGG - Intergenic
948841861 2:240655008-240655030 TAAATTGCCCAGTCTCAGGTAGG - Intergenic
1169650843 20:7865493-7865515 GGAAATGCCCAGCCTCAGCTGGG - Intergenic
1170396712 20:15933613-15933635 GAAAGTGCCAAGGCAGAGCTTGG + Intronic
1174496537 20:50948176-50948198 GGAAATTCCCAGTCAGAGGTAGG - Intronic
1175497497 20:59424606-59424628 CAACCTGCTCAGTCACAGCTGGG + Intergenic
1175512616 20:59542560-59542582 GAAAATACACAGTCAGGGCTGGG - Intergenic
1176612930 21:9002375-9002397 CAAAATGCCTAGAGACAGCTGGG - Intergenic
1176712186 21:10161090-10161112 CAAAATGCCTAGAGACAGCTGGG + Intergenic
1177107732 21:16980643-16980665 GAAAATGCAGAGTCAGACCTTGG - Intergenic
1178383143 21:32128304-32128326 GAGAGTGCCCAGGCACAACTGGG + Intergenic
1178499818 21:33116431-33116453 CAATATACCCAGCCACAGCTGGG + Intergenic
1178998749 21:37433391-37433413 GAAAATGCCCAGGCTGAGTTAGG + Intronic
1179182907 21:39061002-39061024 GCAGATGCCCCGTCAAAGCTGGG - Intergenic
1179996226 21:44975684-44975706 GAAATGCCCCAGTCACAGCCTGG - Intronic
1185295066 22:50049113-50049135 GCAAAGCCCCAGTCACAGCAGGG - Intronic
950668829 3:14513189-14513211 GAAAATACCCAGCCACGGCCTGG - Intronic
952457997 3:33492384-33492406 GAAAATGAGCAGTGACAGTTTGG + Intergenic
953267779 3:41409651-41409673 GAAAATGCAAATTAACAGCTGGG + Intronic
953532937 3:43754416-43754438 GAATATGGCAACTCACAGCTGGG - Intergenic
953660812 3:44890348-44890370 GAAAATGCCCAGTCTCTCCAGGG + Intronic
954075547 3:48176604-48176626 GAAAATACCCAGCCTCAGGTAGG + Intronic
955076834 3:55621747-55621769 GAAAATGCCAGGAGACAGCTAGG + Intronic
955754947 3:62217191-62217213 GAAAATGGGCAGGCACAGCTAGG + Intronic
962113372 3:132474067-132474089 GAAAATGCTCAGTCATAGCTTGG + Intronic
962763936 3:138543543-138543565 GCATCTGCCCAGCCACAGCTTGG - Intronic
963154295 3:142079091-142079113 GAAAATACACAGTCCCAGCCTGG + Intronic
966739139 3:183215785-183215807 GAAGATGCCAAGGGACAGCTTGG + Intronic
968004808 3:195235215-195235237 GAAAATACACAGTTAGAGCTGGG - Intronic
969408268 4:7009692-7009714 CAAATTACCCATTCACAGCTAGG - Intronic
969476162 4:7423573-7423595 TGAAATGTCCAGTCTCAGCTGGG - Intronic
969534092 4:7745474-7745496 GGAAAAGCCCAGGCACCGCTGGG - Intergenic
969570273 4:8004275-8004297 GAAAATGCCAAGCCACAGGCAGG + Intronic
969781053 4:9404456-9404478 GATTATGCCCAGTGAAAGCTGGG - Intergenic
970101057 4:12523537-12523559 GATAATGCCCAGTCACAATGAGG + Intergenic
970645329 4:18114132-18114154 GCAAATGCCCACACACAGATGGG + Intergenic
970716293 4:18928878-18928900 GAATATGCCAAGTTACAGCTGGG - Intergenic
971707210 4:30060539-30060561 GAAAATGCACAGCGACAGCAGGG + Intergenic
972647706 4:40984687-40984709 AAAACTGCCCAGACAAAGCTGGG + Intronic
975546543 4:75566208-75566230 GAGAAAGCCCAGTCAAAGGTAGG - Intergenic
981842940 4:149133495-149133517 AAAGAAGCCCAGTTACAGCTTGG + Intergenic
981990997 4:150920975-150920997 GAAAATGCCCAGTCACAGCTTGG - Intronic
982918969 4:161250177-161250199 GCAGCTGCCCAGTGACAGCTGGG - Intergenic
984333183 4:178353810-178353832 GAAAACACCCATACACAGCTGGG + Intergenic
985396073 4:189545636-189545658 GAAAAGGCCAAGTCTGAGCTGGG + Intergenic
986622358 5:9688933-9688955 GAAATTGCCTAGTCAGAGCCAGG + Intronic
987994909 5:25263977-25263999 GAAAATGCCCAATCTGGGCTGGG - Intergenic
992999049 5:82361913-82361935 GAGAATGCCCAGCGACAGCATGG + Intronic
993535975 5:89087158-89087180 AAACATGCCAAGTCACAGCTCGG + Intergenic
993936852 5:94014833-94014855 GAAAATACACAGTCACAGGAGGG + Intronic
994776351 5:104039730-104039752 GAAACTGGCCATTCACAGATTGG - Intergenic
994840911 5:104923955-104923977 GAAGAGGCCCAGGTACAGCTTGG + Intergenic
995556905 5:113338921-113338943 AAACATGCACAGTCACTGCTAGG - Intronic
996246324 5:121268017-121268039 GAAAATGCCAAATTACATCTAGG + Intergenic
997047418 5:130334940-130334962 GAAAAGACCCAGACACAGCCTGG - Intergenic
998885173 5:146686646-146686668 GGTTATGACCAGTCACAGCTTGG + Intronic
1000728970 5:164807195-164807217 CAAAATGCCCAGGAACAGCAAGG - Intergenic
1001520059 5:172385094-172385116 GAGAATGACCACTCACTGCTTGG - Intronic
1004088148 6:12471863-12471885 GACAATGCCCACTCACAGAAGGG - Intergenic
1004180838 6:13379254-13379276 GAAATTTCCCAATCACAGCAAGG - Intronic
1006299021 6:33184021-33184043 GAAAATGACAAGTCACAGATGGG + Intronic
1009534371 6:64861281-64861303 GAGCATGCCCACACACAGCTGGG + Intronic
1011110519 6:83832898-83832920 TAAATTGCCCAGTCTCAGGTAGG + Intergenic
1011388509 6:86823731-86823753 GATACTGCCCAGCCACACCTGGG - Intergenic
1013185722 6:107756325-107756347 GAAAATGCCACGTCACCTCTGGG + Intronic
1015194591 6:130511086-130511108 GAAATTACACAGTCTCAGCTGGG + Intergenic
1015606213 6:134956938-134956960 TAAAATCCCCAGTCAGGGCTGGG + Intergenic
1017560668 6:155624936-155624958 GAAAGAGCCCTGTGACAGCTGGG - Intergenic
1018198217 6:161373328-161373350 GAAAATTACCCATCACAGCTAGG + Intronic
1018365622 6:163117051-163117073 GAGCATGCCCAGGTACAGCTAGG + Intronic
1018854014 6:167662770-167662792 GAAAGTGCCCAGCCAGTGCTTGG - Intergenic
1022276618 7:28861619-28861641 GAAAATGGTCAGCCACAGCTCGG - Intergenic
1023121518 7:36914046-36914068 GAAACTGGCCAGTGGCAGCTAGG + Intronic
1025529103 7:61854490-61854512 CAAAATGTCCATTCACAGCATGG + Intergenic
1025531368 7:61889198-61889220 CAAAATGCCCATTCACAGAATGG + Intergenic
1027544351 7:79507687-79507709 GGAAATGCACAGTTACACCTTGG + Intergenic
1027924737 7:84446939-84446961 GCAGCTGCCCAGCCACAGCTGGG + Intronic
1032599394 7:133277120-133277142 AAAAATGCCCAGTTATAGCCAGG - Intronic
1034629652 7:152521235-152521257 AAAAATGCCCAGTCACTGCTGGG + Intergenic
1035320642 7:158027141-158027163 GAAAGTGCCCAGCCACAGCCAGG + Intronic
1035897947 8:3425292-3425314 GAAAATGCCCTGTCCCAGCTGGG + Intronic
1036278492 8:7378396-7378418 GATTATGCCCAGTGAAAGCTGGG - Intronic
1036343031 8:7933490-7933512 GATTATGCCCAGTGAAAGCTGGG + Intronic
1036396592 8:8376446-8376468 GGAATTGCTGAGTCACAGCTGGG - Exonic
1036838367 8:12094247-12094269 GATTATGCCCAGTGAAAGCTGGG + Intergenic
1036860158 8:12340495-12340517 GATTATGCCCAGTGAAAGCTGGG + Intergenic
1037454269 8:19047888-19047910 GATGATGCCTACTCACAGCTAGG + Intronic
1037662038 8:20936236-20936258 TAAAATGCTCAAGCACAGCTGGG + Intergenic
1038214008 8:25545190-25545212 TAAATTACCCAGTCTCAGCTGGG - Intergenic
1038245364 8:25849954-25849976 GAAAATGCCCAGTCACCCCAGGG - Intronic
1039752435 8:40490759-40490781 GAAAATTCCAAGCCACAGCTTGG - Intergenic
1040464388 8:47680363-47680385 CATCCTGCCCAGTCACAGCTGGG - Intronic
1040763611 8:50879347-50879369 TAAATTGCCCAGTTTCAGCTAGG + Intergenic
1044351955 8:91176781-91176803 GATAATGCCCAGTCACAATGGGG + Intronic
1045275740 8:100703721-100703743 TAAAATGACCTGTCACAGGTTGG - Intronic
1046958068 8:120082224-120082246 GAGAATGCCAAGGCACAGATAGG + Intronic
1047529861 8:125664921-125664943 CACTGTGCCCAGTCACAGCTGGG + Intergenic
1050888165 9:10790926-10790948 TAAAATCCCTAGTCTCAGCTAGG + Intergenic
1052573780 9:30264910-30264932 GAAAATGCCTTCTCAGAGCTGGG + Intergenic
1052879514 9:33592624-33592646 AAAGATGCACAGGCACAGCTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053496464 9:38551608-38551630 AAAGATGCACAGGCACAGCTTGG - Intronic
1053497328 9:38557786-38557808 AAAGATGCACAGGCACAGCTTGG - Intronic
1053649181 9:40146821-40146843 CAAAATGCCTAGAGACAGCTGGG + Intergenic
1053756563 9:41317063-41317085 CAAAATGCCTAGAGACAGCTGGG - Intergenic
1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG + Intergenic
1054535400 9:66229352-66229374 CAAAATGCCTAGAGACAGCTGGG - Intergenic
1055546997 9:77388013-77388035 GAAAATACGCAGTAACAGCTGGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056936806 9:90921305-90921327 AAACGTGCCCAGACACAGCTTGG - Intergenic
1057386718 9:94611456-94611478 AAAAATGCACATTCACAGCCGGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059058635 9:111011952-111011974 AAAAATGCAGAGTCTCAGCTAGG + Intronic
1059212467 9:112526539-112526561 TAAAGTGCCCAGTCTCGGCTGGG - Intronic
1061314148 9:129783770-129783792 GAAAAACAGCAGTCACAGCTGGG - Intergenic
1061334001 9:129917299-129917321 TAAAAAGAGCAGTCACAGCTGGG - Intronic
1202796939 9_KI270719v1_random:130079-130101 CAAAATGCCTAGAGACAGCTGGG + Intergenic
1186193199 X:7086131-7086153 TAAAATGCCCAGTCACCTCTGGG + Intronic
1187681482 X:21771393-21771415 GACAATGCCCAGTACCAGCTTGG + Intergenic
1187895517 X:23976503-23976525 TAAATTGCCCAGTCTCAGGTAGG - Intergenic
1190099053 X:47506722-47506744 TCAAATGCCCAGTCATGGCTAGG + Intergenic
1192419837 X:71019902-71019924 GAAAATGAACAGCCTCAGCTGGG - Intergenic
1193162778 X:78246390-78246412 AAAATTACCCAGTCTCAGCTGGG - Intergenic
1194335316 X:92639701-92639723 TAAATTGCCCAGTCTCACCTAGG + Intergenic
1195422868 X:104694991-104695013 GATAATGTCCAGCCTCAGCTGGG + Intronic
1198440151 X:136655239-136655261 GAAAAAGCTCAGTCAAGGCTTGG - Intronic
1199628732 X:149761907-149761929 GATAAGGCCCAGTCCCTGCTGGG - Intergenic
1200153338 X:153962271-153962293 GAATAAGCCCAGTCTCAGCGGGG - Exonic
1200643785 Y:5756735-5756757 TAAATTGCCCAGTCTCACCTAGG + Intergenic
1200684585 Y:6247070-6247092 GAAGACGCCCAGTCCCAGATCGG - Intronic
1200830976 Y:7688734-7688756 GAAGACGCCCAGTCCCAGATTGG + Intergenic
1200990114 Y:9338329-9338351 GAAGACGCCCAGTCCCAGATCGG - Intronic
1200992776 Y:9358644-9358666 GAAGACGCCCAGTCCCAGATCGG - Intronic
1200995429 Y:9378922-9378944 GAAGACGCCCAGTCCCAGATCGG - Intronic
1200998094 Y:9399268-9399290 GAAGACGCCCAGTCCCAGATCGG - Intronic
1201000604 Y:9467802-9467824 GAAGACGCCCAGTCCCAGATCGG - Intronic
1201003270 Y:9488132-9488154 GAAGACGCCCAGTCCCAGATCGG - Intronic
1201005927 Y:9508414-9508436 GAAGACGCCCAGTCCCAGATCGG - Intergenic
1201008584 Y:9528727-9528749 GAAGACGCCCAGTCCCAGATCGG - Intronic
1201011160 Y:9548896-9548918 GAAGACGCCCAGTCGCAGATCGG - Intergenic