ID: 981996648

View in Genome Browser
Species Human (GRCh38)
Location 4:150982666-150982688
Sequence TTCCAGAAGGGGAAATGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981996648_981996657 22 Left 981996648 4:150982666-150982688 CCACCACATTTCCCCTTCTGGAA 0: 1
1: 0
2: 2
3: 31
4: 283
Right 981996657 4:150982711-150982733 GATGGGTCAAGTAACAACAGAGG 0: 1
1: 0
2: 1
3: 4
4: 86
981996648_981996655 4 Left 981996648 4:150982666-150982688 CCACCACATTTCCCCTTCTGGAA 0: 1
1: 0
2: 2
3: 31
4: 283
Right 981996655 4:150982693-150982715 TTAAAGGAAGATTACTAAGATGG 0: 1
1: 0
2: 1
3: 28
4: 343
981996648_981996656 5 Left 981996648 4:150982666-150982688 CCACCACATTTCCCCTTCTGGAA 0: 1
1: 0
2: 2
3: 31
4: 283
Right 981996656 4:150982694-150982716 TAAAGGAAGATTACTAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981996648 Original CRISPR TTCCAGAAGGGGAAATGTGG TGG (reversed) Intronic
902037867 1:13470685-13470707 TTCTAGAAGGGGACATGTTCTGG + Intergenic
902320342 1:15658948-15658970 TTAAAGAAAGGGGAATGTGGAGG - Intronic
902633965 1:17723097-17723119 GTCCAAAGGGGGAAATGTGGTGG - Intergenic
903236353 1:21953042-21953064 TTCCAGAGGAGGAGATCTGGTGG - Intergenic
903572707 1:24318176-24318198 TGCCAAAAGGGGAAGGGTGGGGG + Intergenic
903951732 1:26999579-26999601 CTCCATAAGGGGAGAAGTGGAGG + Intronic
904825980 1:33274041-33274063 GTCCACAGGGGGAAATGTGGAGG - Intronic
906613916 1:47222231-47222253 ATCCAGAAGGGGAGATGGTGGGG + Intronic
907151246 1:52290204-52290226 TGGCAGAAGGGCAAATGGGGTGG + Intronic
908748301 1:67396370-67396392 GGCCAGAAAGGGAAATGAGGAGG + Exonic
910258323 1:85272185-85272207 CTCCTGAAGGAGAAATGTTGAGG - Intronic
910622806 1:89274382-89274404 TTCGAGCAGGGAAAATGGGGTGG - Intergenic
910884173 1:91948683-91948705 TTCCTGAAGCGGAAGTCTGGGGG - Intergenic
912008483 1:104932431-104932453 CTTCAGTAGGGGAGATGTGGCGG + Intergenic
912199331 1:107438810-107438832 TTCCAGAAGGGAAAAGTTGGTGG - Intronic
914263194 1:146016651-146016673 TTCTAAAAGGGGAGTTGTGGTGG - Intergenic
915266673 1:154723445-154723467 TTCAAGAAGTGGAATTGAGGAGG + Intronic
916742027 1:167654561-167654583 TTCCAGAAAGGTAACTATGGAGG - Intronic
917491117 1:175499518-175499540 TTCCAGAAGGGAGGGTGTGGAGG - Intronic
918263350 1:182817307-182817329 TTCCATAAGAGGAAAAATGGAGG + Intronic
918849742 1:189671607-189671629 TTCAACAAGGGTAAATGTTGGGG - Intergenic
919434951 1:197546442-197546464 TTCCAGAAGAAGAAATTAGGTGG - Intronic
919775071 1:201189211-201189233 TTCCAGGAGGGGGAAGGAGGAGG - Intergenic
919775080 1:201189242-201189264 TTCCAGGAGGGGGAAGGAGGAGG - Intergenic
921467409 1:215505604-215505626 TTCCAGAGGGAGAAATGTATAGG - Intergenic
921713392 1:218395091-218395113 TTCTGGAAAGGGAAATGAGGGGG + Intronic
923662656 1:235971914-235971936 TTCCAGAAGGGGCCACGTGAGGG - Intergenic
923944264 1:238864926-238864948 TTCAAGGATGGTAAATGTGGGGG + Intergenic
1062855854 10:779256-779278 TTCCAGCAGGCGGAACGTGGAGG + Intergenic
1063107801 10:3008794-3008816 CTCGAGAAGGGGAAATGTGCTGG - Intergenic
1063157654 10:3395211-3395233 TTTCTGAAGGGGATGTGTGGTGG + Intergenic
1063986171 10:11505203-11505225 TGCCAGGAAGGGAAAAGTGGGGG + Intronic
1064861292 10:19828894-19828916 TTCCAGCAGGGCAACTTTGGAGG - Intronic
1065963426 10:30752528-30752550 GCCCAGAAGGGGGACTGTGGAGG + Intergenic
1068048047 10:51912773-51912795 TTTCAGAAGGGGGTAGGTGGGGG - Intronic
1069061007 10:63894418-63894440 TTCCAGGAGGGCTAAGGTGGTGG + Intergenic
1070490192 10:76968864-76968886 TTCCAGAAAGGTGGATGTGGAGG + Intronic
1072834429 10:98695822-98695844 TTCCAGAAGAGGAATTTTAGAGG - Intronic
1073256170 10:102152602-102152624 TTCCAGGTGGGGAAGTCTGGGGG + Intronic
1074278355 10:112026160-112026182 TTCTAGAAGGGGAACTGCCGAGG + Intergenic
1077730550 11:4724652-4724674 TCCCAGAAAGGGATATGAGGTGG + Intronic
1078525584 11:12098608-12098630 TTCCAGTTCGGGAAATGGGGTGG + Intronic
1079609625 11:22415763-22415785 TTCCAGAAGGGGAAAAGAGCTGG + Intergenic
1081554611 11:44146814-44146836 TTCCAGAAGGGGAAGGTTGAAGG + Intronic
1081628374 11:44669910-44669932 TTACAAATGGGGAAATGAGGAGG + Intergenic
1084429276 11:69102268-69102290 TCCCAGAAGGGGAAATAGGTTGG + Intergenic
1085118610 11:73952139-73952161 TTACAGAAGAGGAAGTATGGGGG + Intronic
1085734239 11:79025310-79025332 TGCCAGAAGGGGACATCTAGAGG + Intronic
1087133579 11:94692294-94692316 TGTCAAAAGGGGAAATGTGGAGG - Intergenic
1089649246 11:119901682-119901704 TTCCAGGAGGAGATAGGTGGTGG + Intergenic
1090879594 11:130821946-130821968 TTCCAGCATGGGAAATGGGGAGG - Intergenic
1090901834 11:131038705-131038727 CTCCAGAATGGGGAATGTGAAGG + Intergenic
1090982147 11:131732520-131732542 TTTCAGAAGGGGAAATTGGAAGG + Intronic
1091144500 11:133265822-133265844 AAACAGAAGGGGAAATGTGCCGG + Intronic
1091911516 12:4234232-4234254 TTCCAGATGAGGAAATTTAGAGG - Intergenic
1093874986 12:24339782-24339804 TTCCTGAAGGGGAACTTTTGTGG - Intergenic
1095164579 12:38956680-38956702 ATACAGAAGGGGAAATGTGTAGG - Intergenic
1097920267 12:65064536-65064558 CTCCAGGAGGGAATATGTGGAGG - Intronic
1099347105 12:81515687-81515709 TTCAAAAAGAGAAAATGTGGGGG - Intronic
1099378117 12:81918746-81918768 TGCCAAAAGGAGAAATATGGGGG - Intergenic
1101940998 12:109098658-109098680 TTCCATAAGGGTAAATGTGGAGG + Intronic
1104832917 12:131766612-131766634 GTCCTGCTGGGGAAATGTGGTGG + Intronic
1105943597 13:25171387-25171409 TTCAAGAAGAGGAAATCGGGTGG - Exonic
1106469348 13:30040545-30040567 GTTCAGCAGGGAAAATGTGGCGG + Intergenic
1107658955 13:42619578-42619600 CTCCTAAAGGGGAACTGTGGAGG - Intergenic
1107675894 13:42796594-42796616 TTCCAGGAGCTGAAATGAGGAGG + Intergenic
1108365874 13:49712044-49712066 TTCCAGAGTGGGAAATGGGCTGG - Intronic
1110786065 13:79527873-79527895 TTCCAGTGGGACAAATGTGGAGG + Intronic
1110863310 13:80367554-80367576 TTTCAGAATGAGAAATGTTGGGG - Intergenic
1112332699 13:98488916-98488938 TTACAGCTGGTGAAATGTGGAGG - Intronic
1115206580 14:30912710-30912732 TTACAGATGGAGAAATGTGAAGG - Intronic
1115442389 14:33451245-33451267 TAACATAAGGGGAAATATGGGGG - Intronic
1115445241 14:33482496-33482518 TTACAGAAGTTGAAACGTGGTGG + Intronic
1115972698 14:38963489-38963511 TAGCAGAAAGGGAAATGTTGGGG - Intergenic
1116006522 14:39297462-39297484 CTCCCAAATGGGAAATGTGGAGG - Intronic
1117000722 14:51368543-51368565 TTCCAAAAAGGGAAATGTCTGGG + Intergenic
1117018820 14:51548630-51548652 TTTTGGAAGGGGAAATGTGGGGG + Intronic
1118282695 14:64443934-64443956 CTCCAGAAGGGGCTGTGTGGAGG - Intronic
1119160392 14:72447391-72447413 GGACAGAAGGGGAAATGAGGAGG - Intronic
1119529270 14:75348265-75348287 CTCCAGAAATGGAAATGAGGAGG - Intergenic
1120753307 14:88218317-88218339 TTCCAGGAAGGGGCATGTGGCGG - Intronic
1121105094 14:91274251-91274273 GTCCAGAAGGGGGAATGGTGGGG + Intronic
1121892993 14:97615164-97615186 TTCCAGAAGGAGAAAAGAGGGGG - Intergenic
1124899389 15:33808140-33808162 GTGAAGAAGGGGAGATGTGGAGG + Intronic
1126227009 15:46282593-46282615 TTCAAGAAGGGAAAATCTAGTGG + Intergenic
1127478031 15:59353087-59353109 TTTGAGAAAGGGAAATGTGAAGG - Intronic
1129384595 15:75188938-75188960 TTACAGATGGGGAGCTGTGGAGG + Intergenic
1129519185 15:76175421-76175443 ATCTAGAAGGGGAAATGTCCAGG - Intronic
1129944146 15:79524606-79524628 ACCCAGAAGGGGATATCTGGGGG - Intergenic
1130901798 15:88212848-88212870 TGCCTGAAGGGGAAATGTCAGGG + Intronic
1132337628 15:101058602-101058624 TTGCAGAAGGGGCAACGGGGGGG + Intronic
1134216604 16:12321396-12321418 TTCCAGAGGTGGAAGTGTGGGGG - Intronic
1135841666 16:25882393-25882415 TTCCAGGAGAGGAAATGAGTTGG + Intronic
1137353576 16:47735865-47735887 TTCCAGTCTGGGAAAGGTGGAGG - Intergenic
1137791212 16:51176357-51176379 TTCCAGCAGGGAAGATGTGAAGG - Intergenic
1139113547 16:63921550-63921572 TGCCCCAAGGGGAAATGTGAAGG - Intergenic
1139972604 16:70785634-70785656 TTCCAGAAGGTCAAGTGAGGTGG + Intronic
1141927268 16:87177856-87177878 TTCCAGGAGGGGGATTCTGGGGG + Intronic
1142072745 16:88100180-88100202 TGCCAGATGGGGAGATGTGAGGG - Intronic
1142306402 16:89288347-89288369 ACCCAGAAGGGGAAAGCTGGGGG + Intronic
1143245978 17:5486193-5486215 TGGCGGAAGGGGAAATGGGGTGG - Exonic
1143994646 17:10996217-10996239 CTCCAGTAAGGGAAAAGTGGAGG - Intergenic
1144035438 17:11360857-11360879 TTCCAAAAGGGTATATGGGGTGG + Intronic
1146032148 17:29375452-29375474 TTACAGATGGGGAAAGGTGAGGG + Intergenic
1146402200 17:32508702-32508724 TTTCAGAAGAGGAAATGAGAAGG + Intronic
1146604030 17:34242815-34242837 TTCGAGAAATGGAAATGAGGAGG + Intergenic
1146827976 17:36040625-36040647 TGACTGAAGGGGAAAGGTGGAGG + Intergenic
1148756271 17:49974617-49974639 TTCAAAAAGGGGAGATGGGGAGG - Exonic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1150802390 17:68292041-68292063 TGCCGGAAGGGGAACTGTGGGGG - Intronic
1152176095 17:78788549-78788571 TTCCAGAAGGTGCAAGCTGGAGG + Intronic
1152668556 17:81586919-81586941 TTCCTCCATGGGAAATGTGGTGG - Intronic
1153681443 18:7504762-7504784 TTGAAGGAGGGCAAATGTGGGGG + Intergenic
1154018339 18:10639618-10639640 CTCCAGAAAGGGACATTTGGGGG - Intergenic
1154186534 18:12189972-12189994 CTCCAGAAAGGGACATTTGGGGG + Intergenic
1155028044 18:21960195-21960217 TTGCAGAAGGGGGAAAGGGGTGG - Intergenic
1156200186 18:34821865-34821887 ATCCATAAGGGGCACTGTGGTGG + Intronic
1157788298 18:50506700-50506722 TTTCAGTTGGGGAAATATGGGGG - Intergenic
1158402027 18:57129738-57129760 TTCCATATGGGAAAATGGGGAGG - Intergenic
1158728966 18:60002211-60002233 TTCCAGACAAGCAAATGTGGAGG - Intergenic
1161538247 19:4833197-4833219 CTCAATAAGGGGAACTGTGGGGG - Intergenic
1164048061 19:21559735-21559757 TGCCAGCAGGTGGAATGTGGTGG - Intergenic
1166294457 19:41882322-41882344 TTACAGAAGGGGCATTTTGGAGG + Intergenic
1166577722 19:43858511-43858533 TTCCAGAAGGAGAAAGTTGAGGG + Intergenic
1167762548 19:51458585-51458607 TCCCAGGAGTGGAAATGGGGTGG - Intergenic
925624437 2:5828263-5828285 CTCCATGAGTGGAAATGTGGAGG - Intergenic
926185420 2:10686835-10686857 TGCAGGAGGGGGAAATGTGGGGG + Intronic
926283580 2:11469749-11469771 TTCCTGTGGGGAAAATGTGGAGG - Intergenic
926644770 2:15277817-15277839 TTTTAGAAGGGGAAAGGAGGGGG + Intronic
930758477 2:55004553-55004575 TTTAAGAAGGGGAAAAGTGGGGG + Intronic
931150120 2:59563653-59563675 TTCCAATAGGGGAAATTTGGGGG + Intergenic
931592396 2:63899669-63899691 TGCCAGAATTGGATATGTGGAGG - Intronic
933786291 2:85845252-85845274 TTCCAGAAGGGCAGCTATGGAGG - Intronic
934062006 2:88303513-88303535 TTCCAGAAAGATAAATGAGGTGG - Intergenic
934759765 2:96847875-96847897 TTACAGAAGAGGAAATGGAGGGG + Intronic
936260461 2:110955900-110955922 TTCCAGAAAGGAAAAGATGGGGG - Intronic
936711429 2:115135871-115135893 TGCCAAAAGGGTAAATGTGCAGG + Intronic
937402614 2:121598006-121598028 TTGCAGAAAGGGAAAAGTGGTGG - Intronic
937562569 2:123243978-123244000 TACTAGAGGGGGAAATGAGGGGG - Intergenic
938569356 2:132547979-132548001 TTCCTGAAGGAGAAGTGTGCTGG - Intronic
939616310 2:144365248-144365270 TTCCAGCAGGGGAAATTTTAGGG - Intergenic
941141675 2:161790588-161790610 TTTCAGGATGAGAAATGTGGAGG + Intronic
944102099 2:196037776-196037798 TTCCAGAAGGAGAAAAGATGGGG + Intronic
946625300 2:221605538-221605560 TTCAAGAATGTGAAATGTTGAGG - Intergenic
948437665 2:237965234-237965256 TTCCAGGATGGGAAAGGGGGTGG + Intergenic
948800507 2:240431289-240431311 GTCCAGAAGGGGAGAGGTGGAGG + Intergenic
1169179605 20:3551808-3551830 TAGGTGAAGGGGAAATGTGGTGG - Intronic
1170936787 20:20817449-20817471 TTTCAGTATGGGAAATGTGTTGG + Intergenic
1172476381 20:35241394-35241416 TCCTAGAAGGGCAAATGGGGTGG - Intronic
1172827311 20:37800451-37800473 TTCCTGATGGTGAAATCTGGTGG + Intronic
1173733633 20:45344915-45344937 TTCCAGATGAGGAAATTTGCTGG - Intronic
1174148671 20:48470272-48470294 TCACAGAAGGGGAAATGTGAAGG + Intergenic
1174392803 20:50228348-50228370 TTCCAAAAGGGGAAATCTCTGGG + Intergenic
1174862606 20:54105280-54105302 TTCCAGAAAGGGAAATGTGTGGG + Intergenic
1177003799 21:15646024-15646046 ACCAAGAAGGAGAAATGTGGTGG - Intergenic
1177884353 21:26731249-26731271 TTCCTGAAGGGGAGGTATGGTGG - Intergenic
1179390836 21:40989946-40989968 TTCAAGAAAGGAAAATTTGGTGG + Intergenic
1180032583 21:45222434-45222456 GTTCAGAAGGGGAAATGCTGCGG - Exonic
1180787861 22:18557040-18557062 CTCCAGAAGGAGCCATGTGGAGG - Intergenic
1180903919 22:19395140-19395162 TTGCAGGAGGGATAATGTGGAGG - Intronic
1180998165 22:19975755-19975777 TTCCTGGAAGGGAAAGGTGGTGG + Exonic
1181037386 22:20176440-20176462 TTCCAGCAGTTGAGATGTGGAGG - Intergenic
1181233875 22:21438266-21438288 CTCCAGAAGGAGCCATGTGGAGG + Intronic
1181244772 22:21496565-21496587 CTCCAGAAGGAGCCATGTGGAGG - Intergenic
1181675307 22:24447491-24447513 TGCCAGAGGGAGAAATGTGGTGG + Intergenic
1184124669 22:42478720-42478742 TGGCAGAAGGCGAAAGGTGGCGG - Intergenic
1184497786 22:44852524-44852546 TTCCAGATGGGGGAATGCTGGGG - Intronic
950745282 3:15083011-15083033 CTCCAAAATGGGCAATGTGGTGG - Intronic
952171006 3:30807165-30807187 TTCGAGAAGAGGAAGAGTGGTGG - Intronic
952213426 3:31252211-31252233 TCACAGAAGGGGAATTGGGGGGG + Intergenic
952569895 3:34701740-34701762 GTGCAGAAGGGGATATGTGGGGG - Intergenic
952655423 3:35779873-35779895 GTCCAGAAAGGGAAAGGAGGAGG - Intronic
952960633 3:38587177-38587199 TTCCAGAGGAGCAATTGTGGTGG - Intronic
952984098 3:38762356-38762378 TTCCAGAGGTGGGAATGGGGTGG + Intronic
953102500 3:39843489-39843511 GTCCAGAAGGAGAAAACTGGTGG + Intronic
953437673 3:42891966-42891988 TGCCAGAAGCTGAAGTGTGGGGG + Intronic
954740821 3:52749080-52749102 TTGCAGAAGGGGAAGAGGGGAGG + Intronic
956154309 3:66278781-66278803 TTCCAGAAAGTGAAATTTGCAGG - Intronic
958878356 3:99640803-99640825 ATGCAGAAGGGGAGATTTGGGGG - Intronic
959157112 3:102680122-102680144 TTTGGCAAGGGGAAATGTGGAGG - Intergenic
959602617 3:108205154-108205176 TTTCAGACGGGGAAATATGGAGG + Intronic
959710123 3:109377427-109377449 TTGCAGTAGGGGGAATGTGAAGG + Intergenic
960964593 3:123096057-123096079 TTCCAAAATGGGGAATGGGGAGG - Intronic
963527531 3:146432963-146432985 TTCCAGAAGGAGAAATCAGTTGG - Intronic
963893372 3:150660190-150660212 GTCCAGAAGTGGAACTGGGGAGG + Intronic
964776026 3:160278489-160278511 ATCCAAAAAGGGAAAAGTGGTGG - Intronic
965380107 3:167978201-167978223 TTCCAGATGGGCAGGTGTGGTGG + Intergenic
965735302 3:171813383-171813405 TACCACAAGGGAAAATCTGGGGG - Intergenic
965936952 3:174126141-174126163 TTCAAGAAAGGGAAAGGTGAAGG - Intronic
967224154 3:187275057-187275079 TCCCAGAAGGGGTGAGGTGGGGG - Intronic
967702738 3:192612559-192612581 TTGCAGAATGGGAAATGTCACGG + Intronic
967811595 3:193765643-193765665 TTGCAAAAGGGTAAAAGTGGTGG + Intergenic
968050710 3:195653138-195653160 CCACAGAAGAGGAAATGTGGAGG - Intergenic
968096615 3:195935721-195935743 CCACAGAAGAGGAAATGTGGAGG + Intergenic
968105109 3:195995211-195995233 CCACAGAAGAGGAAATGTGGAGG + Intergenic
968185322 3:196629634-196629656 TACAAGAAAGGGAAGTGTGGCGG - Intergenic
968303406 3:197632793-197632815 CCACAGAAGAGGAAATGTGGAGG + Intergenic
968649702 4:1755656-1755678 TTCCAGACTGGGACATCTGGGGG + Intergenic
970563323 4:17305104-17305126 CTCCAAAAGGGGAGAGGTGGGGG - Intergenic
970686794 4:18577808-18577830 ATTGAGAATGGGAAATGTGGAGG - Intergenic
970756142 4:19429052-19429074 TTGAAGAATGGTAAATGTGGGGG + Intergenic
970964013 4:21907091-21907113 TTCCAGCACGTGAATTGTGGGGG - Intronic
972009283 4:34155985-34156007 TTCAAGAAGGGTAAATATAGAGG + Intergenic
973721755 4:53731162-53731184 TTCCATTTGGGGCAATGTGGTGG - Intronic
977420334 4:96791658-96791680 TTCCTGAAAGGGAAAAGTGTAGG + Intergenic
978128495 4:105164552-105164574 TTCCAGAAGGGTAAAGATGATGG - Intronic
978439373 4:108717427-108717449 CTGCAGGAGGGGAAATGTGGAGG - Intergenic
979716099 4:123840497-123840519 TTACAGATGAGGAAATGGGGAGG + Intergenic
980006161 4:127544623-127544645 TTGAAGAATGGTAAATGTGGGGG - Intergenic
980524758 4:133975329-133975351 TGGGGGAAGGGGAAATGTGGAGG + Intergenic
981793121 4:148562728-148562750 TTTCAGGAGGAGAAATGTGGAGG - Intergenic
981996648 4:150982666-150982688 TTCCAGAAGGGGAAATGTGGTGG - Intronic
982650218 4:158079144-158079166 TTCCTGAAGGAGAGAAGTGGAGG - Intergenic
983972646 4:173893528-173893550 TTCCAGAAGTGGTGATGGGGAGG + Intergenic
984692913 4:182748809-182748831 GTCCAGAAGAACAAATGTGGGGG - Intronic
985507504 5:292167-292189 CCACAGAAGAGGAAATGTGGAGG - Intronic
985740469 5:1612965-1612987 CCACAGAAGAGGAAATGTGGAGG + Intergenic
985872684 5:2569903-2569925 TTCCAGAAGGTGGAATGCTGTGG + Intergenic
986399729 5:7369151-7369173 TTCCGTAAGAGGAAGTGTGGTGG + Intergenic
986420856 5:7580094-7580116 TACTAGAAGGGGAAAGGAGGAGG + Intronic
988595161 5:32584381-32584403 TTCTAGAAAGGGACGTGTGGGGG + Intronic
990999303 5:61766988-61767010 CAGCAGAAAGGGAAATGTGGAGG - Intergenic
992157448 5:73969217-73969239 TTCAAGATAGGGAAAGGTGGGGG + Intergenic
992870199 5:80998146-80998168 TTCCAGAAGCGGAAATGCCTGGG + Intronic
995548440 5:113255780-113255802 GTCCAGGAGGGCAAATGTGGTGG - Intronic
995731871 5:115253451-115253473 TTTCAAAAGGGGACATTTGGGGG + Intronic
995807765 5:116072961-116072983 CTCCAGAAGGGAATATGTAGAGG - Intergenic
998081337 5:139277369-139277391 TTCCACAGGAGGAAATGGGGAGG + Intronic
998253014 5:140565055-140565077 TCCCAGGAGGGGACATCTGGGGG - Exonic
998374891 5:141683692-141683714 TTTCAGATGGGCAACTGTGGTGG + Intergenic
999084313 5:148873658-148873680 TTCCACATGGGGAAGTGTAGAGG - Intergenic
999201094 5:149816861-149816883 ATCCAGGAGGGGACAGGTGGTGG - Intronic
999354443 5:150911486-150911508 TGCCAGTAGAGAAAATGTGGAGG - Intergenic
999710836 5:154316949-154316971 TTGGAGATGGGTAAATGTGGAGG - Intronic
999770761 5:154773880-154773902 TTGCAGAAGGGGACATGGGTTGG + Intronic
1000689014 5:164291391-164291413 TTCCAGAAGAGGAAATTTGATGG - Intergenic
1001034638 5:168288934-168288956 TTTCAGAAGGGGAAAGGACGTGG + Intergenic
1003220822 6:4159521-4159543 TTCCAGAAGCTGCATTGTGGAGG - Intergenic
1004027618 6:11834487-11834509 TTTAAGAAGGGGAATTCTGGCGG - Intergenic
1005620732 6:27617779-27617801 TTCCACAAGGGGAAAGGGGCCGG - Intergenic
1008609771 6:53174950-53174972 TGTCAGAAGGGGACGTGTGGTGG - Intergenic
1008959490 6:57251650-57251672 ATACAGAAGGGGAAATGAGCTGG + Intergenic
1009643800 6:66371607-66371629 TTCCAGACAAGGAAATGTTGAGG - Intergenic
1010335681 6:74680405-74680427 TTCTATATGGTGAAATGTGGGGG - Intergenic
1010567256 6:77431381-77431403 TTGCAGAAGAGGAAAGATGGGGG - Intergenic
1013747833 6:113366795-113366817 TTTCAGAAGGTTAACTGTGGAGG + Intergenic
1016251050 6:142043326-142043348 TTCAGGAAGAGGAAATGTGGAGG + Intergenic
1016391251 6:143578290-143578312 TCCTAGAAGGGGAAACATGGAGG - Intronic
1017005832 6:150027569-150027591 GTCCAGGAGGGGCCATGTGGAGG + Intergenic
1017009079 6:150050557-150050579 TCACAGAAGAGGAAATGTGAAGG + Intergenic
1017289621 6:152720778-152720800 ATCATGGAGGGGAAATGTGGGGG + Intronic
1018276421 6:162136833-162136855 TGCCTGAAAGGGAAATGTAGAGG + Intronic
1019265515 7:115339-115361 GTCCAGAAGGGGAAACTTGGCGG - Intergenic
1019725563 7:2600457-2600479 GACCACAAGGGGAAAGGTGGTGG - Intronic
1022991087 7:35707955-35707977 TTCAGGAAGGGAAAATGTTGAGG + Intergenic
1023042692 7:36186012-36186034 TTCCAGAAAGGAAAAAGTGAGGG - Intronic
1024282550 7:47731502-47731524 TTCCAGAACTGGAACTGTGAGGG + Intronic
1028241026 7:88420785-88420807 TTCTAGTAGAGGAAATATGGAGG + Intergenic
1029102609 7:98145237-98145259 TTACAGAAAGGGAAATGAAGAGG + Intronic
1029942691 7:104496867-104496889 TCCCAGAAGGGAAAACTTGGAGG + Intronic
1031560974 7:123237719-123237741 TTCCAAAAGGGGACAGGTAGTGG + Intergenic
1033657800 7:143384817-143384839 GTCCAGAAGGGGAAATGGTTTGG + Intronic
1033685891 7:143641143-143641165 ATGCCGAAGGGTAAATGTGGAGG + Intronic
1033689852 7:143726172-143726194 ATGCCGAAGGGTAAATGTGGAGG - Intronic
1033698722 7:143816478-143816500 ATGCCGAAGGGTAAATGTGGAGG - Intergenic
1034921248 7:155084219-155084241 AGCCAGAAGGGGACACGTGGCGG + Exonic
1037850588 8:22324352-22324374 TTTCAAAAGTGGAAAGGTGGGGG - Intronic
1038291417 8:26252984-26253006 ATGCAGAATGGAAAATGTGGAGG - Intergenic
1038435855 8:27535569-27535591 TTCCAGAAGTTGAAAGATGGTGG - Intronic
1038478120 8:27883212-27883234 TTCTCCAAGGGGAAATGTTGGGG + Intronic
1038596849 8:28894593-28894615 ATCCAGTAAGGGCAATGTGGGGG - Intronic
1038649329 8:29388223-29388245 TTTCAGAAGGGGAAAATTGCTGG + Intergenic
1038675779 8:29621708-29621730 TCCCAGAAGTGGAAATGCTGGGG + Intergenic
1039719852 8:40151583-40151605 TTCCACTAGGGAGAATGTGGAGG - Intergenic
1040333899 8:46406409-46406431 TTCCAGAAGTGAAAATGGGGGGG + Intergenic
1040687398 8:49891136-49891158 TTCCAGAAGGGGGAAGGCGGGGG + Intergenic
1041082593 8:54227509-54227531 TTCCAAGAAGGAAAATGTGGTGG - Intergenic
1041223613 8:55676153-55676175 TTCAAGATGTGGAAATGTTGAGG + Intergenic
1042020511 8:64369091-64369113 TGCCAGGAGGGAAAATGTCGGGG - Intergenic
1043254568 8:78118105-78118127 TTCCAGCAGGTGAAAAGTGAAGG + Intergenic
1046488069 8:114911420-114911442 TTCCAGAAAAGCAAATGTGAAGG + Intergenic
1046491332 8:114955957-114955979 TTGGGGAAAGGGAAATGTGGAGG + Intergenic
1047227409 8:122968458-122968480 TTTAAAAAGGGGAAATGTGTTGG - Intronic
1047326475 8:123842301-123842323 TTCCAAAAGGAGAAAAATGGAGG - Intergenic
1048255153 8:132900104-132900126 CTCCAGACGGAGAGATGTGGAGG - Intronic
1048468180 8:134684830-134684852 TTCCAGAACTGCAAATGTGGGGG + Intronic
1050256457 9:3797056-3797078 TCTCTGAGGGGGAAATGTGGGGG + Intergenic
1050676518 9:8061865-8061887 TTCCAGAAAAGGAAAAGTTGGGG - Intergenic
1051728865 9:20117278-20117300 TCCCAGAAGTTGCAATGTGGAGG + Intergenic
1054805543 9:69393296-69393318 TGCCAGAGTGGGAACTGTGGTGG + Intergenic
1055294509 9:74820544-74820566 TGCCAGAAGAGCAAATGAGGGGG + Intronic
1055803492 9:80067162-80067184 TCCCTGCAGGGAAAATGTGGAGG + Intergenic
1056687214 9:88776541-88776563 TTCCAAAAGGGGAAAATGGGGGG - Intergenic
1056797812 9:89670637-89670659 CTCCAGAAGGGCTAAGGTGGTGG - Intergenic
1057962169 9:99467335-99467357 TTCCAGAAGGGATGATCTGGAGG - Intergenic
1058078533 9:100675944-100675966 TGCCAGAAAAGGAAATGAGGAGG - Intergenic
1058876935 9:109252580-109252602 TTCCAGAAGGGAACAAGTAGAGG + Intronic
1059479402 9:114576660-114576682 TTCAAGAATGGGAAGTGTAGAGG + Intergenic
1059653435 9:116335739-116335761 TTCAAGAAGTGGTAATGTGGAGG - Intronic
1060069856 9:120536626-120536648 TTCAGGGAGGGGAAATGTGCTGG - Intronic
1061158477 9:128879675-128879697 GTCCAGAAGGAGAAATGATGAGG - Intronic
1203567567 Un_KI270744v1:104752-104774 CTCAAATAGGGGAAATGTGGTGG - Intergenic
1188245120 X:27829913-27829935 TTCCAGAAGGCGAAGTGAAGGGG - Intergenic
1189602781 X:42645226-42645248 CTGCTGAAGGGGAATTGTGGGGG + Intergenic
1189709608 X:43795872-43795894 TTCCAGGAGAGGAAATTTGTGGG - Exonic
1191882479 X:65856797-65856819 TTTAAGAAAGTGAAATGTGGGGG - Intergenic
1193162899 X:78247727-78247749 TTCCAGAAGGGGAAAATGGGTGG + Intergenic
1195322433 X:103730513-103730535 GTCCAGAAGGGTAAGAGTGGAGG - Intergenic
1197891253 X:131272898-131272920 TTCCAAATGGGGAAATGGTGGGG - Intergenic
1198483679 X:137065121-137065143 ATTCAGAATGGGAACTGTGGTGG + Intergenic
1198483935 X:137067527-137067549 ATTCAGAATGGGAATTGTGGTGG - Intergenic
1198508760 X:137328046-137328068 CTCAGGAAGGGGAAATATGGTGG - Intergenic
1198972292 X:142295879-142295901 CTCCAGAAGGGCAAAAGTGAAGG + Intergenic
1200510144 Y:4067548-4067570 TTCCTGAAGGGCAATAGTGGAGG - Intergenic
1201762957 Y:17558714-17558736 TTCCAGCAGGGGTAGGGTGGAGG - Intergenic
1201838595 Y:18347275-18347297 TTCCAGCAGGGGTAGGGTGGAGG + Intergenic
1201960571 Y:19676710-19676732 TTCCAGATGAGGGAAAGTGGAGG - Intergenic