ID: 981999232

View in Genome Browser
Species Human (GRCh38)
Location 4:151007166-151007188
Sequence AAGTGCCAAGGTAATTCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981999229_981999232 9 Left 981999229 4:151007134-151007156 CCTTACATTTATGCTCAACTGAT 0: 1
1: 14
2: 98
3: 424
4: 1191
Right 981999232 4:151007166-151007188 AAGTGCCAAGGTAATTCAATGGG No data
981999228_981999232 19 Left 981999228 4:151007124-151007146 CCAGATAAATCCTTACATTTATG 0: 1
1: 0
2: 1
3: 19
4: 298
Right 981999232 4:151007166-151007188 AAGTGCCAAGGTAATTCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981999232 Original CRISPR AAGTGCCAAGGTAATTCAAT GGG Intronic
No off target data available for this crispr