ID: 982004283

View in Genome Browser
Species Human (GRCh38)
Location 4:151049423-151049445
Sequence CAGGATGGCCTGCCGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982004273_982004283 10 Left 982004273 4:151049390-151049412 CCGGAGGATGGCCTGCCGGAGGA No data
Right 982004283 4:151049423-151049445 CAGGATGGCCTGCCGGAGGATGG No data
982004270_982004283 14 Left 982004270 4:151049386-151049408 CCTGCCGGAGGATGGCCTGCCGG No data
Right 982004283 4:151049423-151049445 CAGGATGGCCTGCCGGAGGATGG No data
982004277_982004283 -5 Left 982004277 4:151049405-151049427 CCGGAGGATGGCCTGCCGCAGGA No data
Right 982004283 4:151049423-151049445 CAGGATGGCCTGCCGGAGGATGG No data
982004275_982004283 -1 Left 982004275 4:151049401-151049423 CCTGCCGGAGGATGGCCTGCCGC No data
Right 982004283 4:151049423-151049445 CAGGATGGCCTGCCGGAGGATGG No data
982004268_982004283 25 Left 982004268 4:151049375-151049397 CCGGAGGATGGCCTGCCGGAGGA No data
Right 982004283 4:151049423-151049445 CAGGATGGCCTGCCGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982004283 Original CRISPR CAGGATGGCCTGCCGGAGGA TGG Intergenic
No off target data available for this crispr