ID: 982005326

View in Genome Browser
Species Human (GRCh38)
Location 4:151057862-151057884
Sequence CTAATTTTGTAGTAGAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982005326_982005331 -10 Left 982005326 4:151057862-151057884 CCCCGTCTCTACTACAAAATTAG No data
Right 982005331 4:151057875-151057897 ACAAAATTAGCCAGGCATGGTGG 0: 3547
1: 23769
2: 82019
3: 147603
4: 196057
982005326_982005333 16 Left 982005326 4:151057862-151057884 CCCCGTCTCTACTACAAAATTAG No data
Right 982005333 4:151057901-151057923 ATGCCTGTAATCCCAACTGCTGG 0: 3
1: 74
2: 1691
3: 4475
4: 8950
982005326_982005335 18 Left 982005326 4:151057862-151057884 CCCCGTCTCTACTACAAAATTAG No data
Right 982005335 4:151057903-151057925 GCCTGTAATCCCAACTGCTGGGG 0: 5
1: 350
2: 11208
3: 140285
4: 298535
982005326_982005334 17 Left 982005326 4:151057862-151057884 CCCCGTCTCTACTACAAAATTAG No data
Right 982005334 4:151057902-151057924 TGCCTGTAATCCCAACTGCTGGG 0: 48
1: 3079
2: 61371
3: 122860
4: 282177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982005326 Original CRISPR CTAATTTTGTAGTAGAGACG GGG (reversed) Intergenic
No off target data available for this crispr