ID: 982010229

View in Genome Browser
Species Human (GRCh38)
Location 4:151099071-151099093
Sequence CTGCTTGTTGATGTGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982010229_982010231 -3 Left 982010229 4:151099071-151099093 CCAGCATCCACATCAACAAGCAG No data
Right 982010231 4:151099091-151099113 CAGAACGTCGCTAGCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982010229 Original CRISPR CTGCTTGTTGATGTGGATGC TGG (reversed) Intergenic
No off target data available for this crispr