ID: 982010231

View in Genome Browser
Species Human (GRCh38)
Location 4:151099091-151099113
Sequence CAGAACGTCGCTAGCATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982010228_982010231 8 Left 982010228 4:151099060-151099082 CCTGAGATGAACCAGCATCCACA No data
Right 982010231 4:151099091-151099113 CAGAACGTCGCTAGCATCTCTGG No data
982010230_982010231 -10 Left 982010230 4:151099078-151099100 CCACATCAACAAGCAGAACGTCG No data
Right 982010231 4:151099091-151099113 CAGAACGTCGCTAGCATCTCTGG No data
982010229_982010231 -3 Left 982010229 4:151099071-151099093 CCAGCATCCACATCAACAAGCAG No data
Right 982010231 4:151099091-151099113 CAGAACGTCGCTAGCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982010231 Original CRISPR CAGAACGTCGCTAGCATCTC TGG Intergenic
No off target data available for this crispr