ID: 982011878

View in Genome Browser
Species Human (GRCh38)
Location 4:151113441-151113463
Sequence TCCCTTCCAGCTAGGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 0, 2: 8, 3: 71, 4: 634}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982011878_982011881 6 Left 982011878 4:151113441-151113463 CCACCATGCCTAGCTGGAAGGGA 0: 1
1: 0
2: 8
3: 71
4: 634
Right 982011881 4:151113470-151113492 TAATGCACAATTTGTTCCCTAGG No data
982011878_982011884 24 Left 982011878 4:151113441-151113463 CCACCATGCCTAGCTGGAAGGGA 0: 1
1: 0
2: 8
3: 71
4: 634
Right 982011884 4:151113488-151113510 CTAGGTCAGTTTCTCAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982011878 Original CRISPR TCCCTTCCAGCTAGGCATGG TGG (reversed) Intronic