ID: 982011881

View in Genome Browser
Species Human (GRCh38)
Location 4:151113470-151113492
Sequence TAATGCACAATTTGTTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982011880_982011881 -2 Left 982011880 4:151113449-151113471 CCTAGCTGGAAGGGAAATAATTA 0: 1
1: 0
2: 2
3: 26
4: 223
Right 982011881 4:151113470-151113492 TAATGCACAATTTGTTCCCTAGG No data
982011878_982011881 6 Left 982011878 4:151113441-151113463 CCACCATGCCTAGCTGGAAGGGA 0: 1
1: 0
2: 8
3: 71
4: 634
Right 982011881 4:151113470-151113492 TAATGCACAATTTGTTCCCTAGG No data
982011879_982011881 3 Left 982011879 4:151113444-151113466 CCATGCCTAGCTGGAAGGGAAAT 0: 1
1: 0
2: 1
3: 21
4: 297
Right 982011881 4:151113470-151113492 TAATGCACAATTTGTTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982011881 Original CRISPR TAATGCACAATTTGTTCCCT AGG Intronic