ID: 982012006

View in Genome Browser
Species Human (GRCh38)
Location 4:151114617-151114639
Sequence CACAGCCCTGAGAAGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 324}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982012006_982012013 27 Left 982012006 4:151114617-151114639 CCTGGCCACTTCTCAGGGCTGTG 0: 1
1: 0
2: 6
3: 51
4: 324
Right 982012013 4:151114667-151114689 GATGAGGTAACGTCTCCCCCAGG No data
982012006_982012008 5 Left 982012006 4:151114617-151114639 CCTGGCCACTTCTCAGGGCTGTG 0: 1
1: 0
2: 6
3: 51
4: 324
Right 982012008 4:151114645-151114667 ACCCTTGTGAGCAACCTTGAAGG 0: 1
1: 0
2: 3
3: 11
4: 76
982012006_982012011 11 Left 982012006 4:151114617-151114639 CCTGGCCACTTCTCAGGGCTGTG 0: 1
1: 0
2: 6
3: 51
4: 324
Right 982012011 4:151114651-151114673 GTGAGCAACCTTGAAGGATGAGG 0: 2
1: 3
2: 10
3: 42
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982012006 Original CRISPR CACAGCCCTGAGAAGTGGCC AGG (reversed) Intronic
901053166 1:6435844-6435866 CAGAGCCCTGAGCACAGGCCTGG - Intronic
901053642 1:6438336-6438358 CAGAGCCCTGAGCACAGGCCTGG - Intronic
901221595 1:7586748-7586770 GACAGCCCTGAGATGTGACCAGG + Intronic
901246567 1:7736487-7736509 CATAGCCCTGGGCAGCGGCCAGG - Exonic
901631472 1:10650112-10650134 GACTGCCCTGAGGAGGGGCCGGG - Intronic
901645935 1:10716771-10716793 CTCAGCCCAGGGAGGTGGCCTGG - Intronic
902481073 1:16712205-16712227 CAGAGCCCTGAGCACAGGCCTGG + Intergenic
902781156 1:18705831-18705853 CCCAGCCCTGAGGAATGGGCTGG - Intronic
903035938 1:20492589-20492611 GATAGCCCTGTGAAGTGGGCAGG + Intergenic
904835801 1:33335283-33335305 AACAGCCCTGGGAAGGGGGCGGG - Intronic
904916484 1:33974024-33974046 GACAGCCCTGAGCAATGGCCTGG + Intronic
907044899 1:51294708-51294730 CCCAGCCATAGGAAGTGGCCAGG - Intronic
908000230 1:59672157-59672179 CACAGCCCTGTAGTGTGGCCTGG + Intronic
911104420 1:94118692-94118714 CCCAGCCCTGGGAGGTGCCCTGG + Intronic
911182938 1:94877104-94877126 CACAGCTTGGAGAAGTGGCAAGG - Intronic
913997994 1:143667222-143667244 TACAGCCCAAAGCAGTGGCCAGG - Intergenic
914433476 1:147640408-147640430 CACAGCCCTGAGGAATGCTCCGG + Intronic
915259257 1:154664565-154664587 GAGGGCCCTGAGAAGAGGCCTGG - Intergenic
915348617 1:155211081-155211103 CACAGCCCTGAGAGGTTACATGG - Intronic
915351807 1:155231709-155231731 CACAGCCCTGAGAGGTTACATGG - Intergenic
915468218 1:156110505-156110527 CACTGACCTGAAAAGTGGCAGGG + Intronic
915770547 1:158417938-158417960 CACAACACTGACAAGTGGGCAGG - Intergenic
916215151 1:162387483-162387505 CACACAGCTGAGAATTGGCCAGG + Intergenic
916457391 1:164984864-164984886 CACAGCCCTGAAATGGGGTCGGG + Intergenic
918226282 1:182486056-182486078 CACTGCTCTGAGAAGGGGCCGGG + Intronic
918233347 1:182555694-182555716 AACAGGCCTGAGAAGTGACTTGG - Intronic
918668685 1:187185084-187185106 CAAGGCCCTGAGAAGAGGCAGGG - Intergenic
920373396 1:205493404-205493426 CACAGCCCAGAGAAATGCCCGGG - Intergenic
920865464 1:209748438-209748460 CCCAGCCTTGAGAGGTGGACCGG - Intergenic
921045170 1:211471372-211471394 AACTGGCCTGAGATGTGGCCTGG + Intergenic
921348130 1:214208084-214208106 CAAAGACCTGAGAAGGGGTCTGG - Intergenic
921557161 1:216612553-216612575 CACAGACCAGAGAAGTGGGGAGG - Intronic
921704508 1:218306460-218306482 CACAACCCTGAGAAATGGCCTGG + Intronic
921808667 1:219486459-219486481 CACAGGGCTGAGAAGTGGGTAGG - Intergenic
922190244 1:223312560-223312582 CACAGCTCTGAGAGATGGACAGG - Intronic
923743707 1:236681340-236681362 CACAACCCTGAGAAATGGGCGGG + Intergenic
924548841 1:245055166-245055188 CATAGCCCTGAGAGATGGTCAGG + Intronic
1063579250 10:7290983-7291005 CACGTCCCTGAGAGGTGACCCGG - Intronic
1066435373 10:35392691-35392713 TACAGCTCTGAGGACTGGCCTGG - Intronic
1067251421 10:44589980-44590002 CACAGCCCAGAGAAGAGGGCCGG + Intergenic
1067252591 10:44600491-44600513 CACAGAACTGAGTAGTGACCTGG - Intergenic
1067259969 10:44680904-44680926 CAAAACGCTGAGAAGTTGCCGGG - Intergenic
1069591980 10:69647832-69647854 AAGAGCACTGACAAGTGGCCAGG + Intergenic
1069780720 10:70953710-70953732 CACAGCCCTGGGAGGTGAGCTGG + Intergenic
1070749225 10:78954167-78954189 CACACCCCTCAGAAGGGGCAGGG + Intergenic
1071272125 10:84017568-84017590 CACAGCTTTGAGAAGTGGGAGGG + Intergenic
1071716294 10:88099652-88099674 CACAGCTGTGAGAAGCTGCCAGG - Intergenic
1072805105 10:98419101-98419123 CACAGCCCTGTAAAGTGGCTGGG - Intronic
1072805175 10:98419445-98419467 CACAGCCCTGTGCAGTGGCTGGG + Intronic
1073053671 10:100685641-100685663 CAGAGCCCTTGGAAGTGGCCAGG + Intergenic
1073067435 10:100771274-100771296 CACAGCTCTGAAGAATGGCCTGG + Intronic
1075100979 10:119506133-119506155 TCCAGCCCTCAGAAGTGGCTGGG + Intronic
1075130001 10:119729440-119729462 AACAGCCCTAAAAAGAGGCCAGG - Intronic
1076104267 10:127808092-127808114 AACACCTCTGAAAAGTGGCCCGG + Intergenic
1076268192 10:129127246-129127268 CACAGCTCTGAGAAGGGCCCAGG + Intergenic
1076375783 10:129983786-129983808 CACAGCCCTGAAAGGTAGCCTGG + Intergenic
1076534477 10:131167988-131168010 CACACCCATGAGACCTGGCCAGG - Intronic
1076669783 10:132113357-132113379 CACAGCCCTGAGATGCTGCCAGG + Intronic
1076782299 10:132731064-132731086 CACAGCCCTGAGGTGGGCCCTGG + Intronic
1077078314 11:711105-711127 CTGAGCCCTGAGAAGCAGCCCGG - Intronic
1077148176 11:1055173-1055195 AACAAAACTGAGAAGTGGCCTGG + Intergenic
1077438133 11:2554523-2554545 CAGTGCCCTGAGAGGGGGCCTGG + Intronic
1078460380 11:11510780-11510802 CCCAGCCCTGAGATTTGCCCTGG - Intronic
1078582168 11:12547129-12547151 CAGAGGGCTGAGAAGGGGCCAGG - Intergenic
1078922019 11:15839577-15839599 CACAGCCTCCAGAGGTGGCCGGG + Intergenic
1078933995 11:15936327-15936349 CACAGCTCTGAGGAATGGCAAGG + Intergenic
1080041017 11:27759531-27759553 CAAAGCCCAAAAAAGTGGCCAGG + Intergenic
1080640177 11:34154138-34154160 CACTGCCCTCAGAAGCAGCCTGG + Intronic
1080646645 11:34192714-34192736 CAGACCCTTGAGGAGTGGCCAGG - Intronic
1081853268 11:46288610-46288632 AAGAGCCCTGAGAAGTGGCCTGG - Intronic
1083110021 11:60397172-60397194 CACAGCCCAGAGATGTGGCCTGG + Intronic
1083668348 11:64287082-64287104 CTCAGCCCTGAGAGGTGGGAAGG - Intronic
1083682765 11:64358987-64359009 CACGGCCCTGAGGCCTGGCCTGG + Intergenic
1084675260 11:70630309-70630331 CACAGTCCTCAGCCGTGGCCTGG - Intronic
1084778784 11:71395583-71395605 CACAGTCCTAAGAGGTGGCTGGG - Intergenic
1085058597 11:73424160-73424182 CACAGCCCACAGCAGTGGCAAGG + Intronic
1086668003 11:89508718-89508740 CACAGCATTGAGAACAGGCCTGG - Intergenic
1087168380 11:95026241-95026263 CACAGCCCCGAGAAATGTCTGGG - Exonic
1089174561 11:116539123-116539145 CGAAGTCATGAGAAGTGGCCAGG - Intergenic
1089641339 11:119849232-119849254 CACAGCCCTAAGAGGTGGAAGGG + Intergenic
1089702641 11:120254755-120254777 CAGAGCCCTCATAAGTGGCTGGG + Intronic
1089703077 11:120257388-120257410 CCCTTCCCTCAGAAGTGGCCCGG + Intronic
1091501383 12:1021311-1021333 CACAATCCTGAAAAATGGCCTGG - Intronic
1091698191 12:2642032-2642054 GACGGGCCTGAGAAGTGGCCTGG + Intronic
1093758804 12:22881928-22881950 GGCAGCCCTGACAAATGGCCAGG + Intergenic
1093895509 12:24570524-24570546 CATAACCCTGAGAAACGGCCTGG - Intergenic
1094391720 12:29958870-29958892 CACAGACCTCACATGTGGCCTGG - Intergenic
1095088263 12:38082160-38082182 CGCAGCCCTGGGAAGTGGTTTGG - Intergenic
1096519958 12:52179395-52179417 CACAGCCCTGAAAAGCTTCCTGG - Intronic
1097640518 12:62175323-62175345 CAAGGCCCAGAGAAGTAGCCAGG - Intronic
1100209100 12:92382915-92382937 CACAGCCTTGAGTTGTGTCCAGG + Intergenic
1100473236 12:94912595-94912617 CAAAGCCCTGAGAACTGGGGAGG - Intronic
1101331093 12:103758533-103758555 CATTGCCCTGAGAACTCGCCTGG - Intronic
1103603273 12:122067904-122067926 CACAACCCTGGGAGGTGGGCAGG - Intergenic
1103847112 12:123909212-123909234 CACAACCCCGGGATGTGGCCAGG - Intronic
1104471274 12:129031828-129031850 CTCAGCCCTGGTCAGTGGCCCGG + Intergenic
1104733344 12:131121173-131121195 CACAGCCCTGAGAACAGCACAGG + Intronic
1105339590 13:19507991-19508013 CACAACCCAGAGGAGTTGCCTGG + Intronic
1106009937 13:25810328-25810350 CTGAGCCTTGAGATGTGGCCAGG - Intronic
1108582396 13:51838444-51838466 CACAACTCTGAGAAATGCCCTGG - Intergenic
1109852866 13:68090039-68090061 CTCAGCCTTGATAAGTGGACAGG - Intergenic
1110405067 13:75141838-75141860 CAGAGCTCTGAGAAGTAGGCAGG + Intergenic
1110804336 13:79736777-79736799 CACCCCCCAGAAAAGTGGCCAGG - Intergenic
1114977196 14:28116831-28116853 CACAGCCCTTAGCAGTAGGCAGG - Intergenic
1115886388 14:37976400-37976422 CACAGACCTGGGAAGGGGTCTGG - Intronic
1116864256 14:50018514-50018536 GACAGCCCTCATAAGAGGCCAGG + Intergenic
1117479425 14:56128577-56128599 CAGAGCCTTGAGAGGTGACCTGG + Intronic
1118720822 14:68592559-68592581 CATAGATCTGAGAAGTGGCAGGG + Intronic
1118901737 14:69992047-69992069 CTCAGCCCTGAGTTATGGCCAGG - Intronic
1119378653 14:74214740-74214762 CACAGAACTCACAAGTGGCCAGG - Intergenic
1119441952 14:74634497-74634519 CTCAGGCCTGAGAAGGGACCAGG + Intergenic
1119735097 14:76976565-76976587 CGCTGCCCTGAAACGTGGCCAGG + Intergenic
1119979562 14:79064191-79064213 CACAGCCGTGAGTAGAGCCCAGG + Intronic
1120007652 14:79378206-79378228 CTCATCCCAGAGAAGTGGCCGGG + Intronic
1121021329 14:90581943-90581965 CACAGCACTGAAAAGTGCCATGG - Intronic
1121452262 14:94016501-94016523 CACAGGCCTCCCAAGTGGCCTGG - Intergenic
1122138280 14:99647005-99647027 CCCAGCCCTGGGAAGGGTCCAGG + Intronic
1122200546 14:100120034-100120056 CACAGCCCTGAGAAAAAGGCTGG + Intronic
1122284124 14:100640742-100640764 CACTTCCCTGGGAAGCGGCCAGG - Intergenic
1122810526 14:104285465-104285487 CAGGGCCGTGAGCAGTGGCCAGG + Intergenic
1123684548 15:22787379-22787401 CACAGCCCTGAGAGCCCGCCCGG - Intronic
1124838042 15:33214697-33214719 CACAACCTTGAGAAAAGGCCTGG - Intergenic
1127499685 15:59544510-59544532 CACAGCCCTGGGAGGTGGCTGGG + Intergenic
1127974608 15:63987900-63987922 AACAACCCTGGGAAGTGGGCAGG - Intronic
1128106831 15:65051472-65051494 CAGAGCCCTGAGGAATGGCCAGG - Intronic
1128334964 15:66779867-66779889 CACAGCTCTGAGAAGCAGGCAGG - Intronic
1128357575 15:66938872-66938894 CACCTCCCTCAGTAGTGGCCAGG - Intergenic
1128648947 15:69396635-69396657 CACAGCCCTGAACTGAGGCCTGG - Intronic
1128983941 15:72205919-72205941 TCCAACCCTGAGCAGTGGCCAGG + Intronic
1129704147 15:77784982-77785004 CACAGCCCTGGGGAGTAGCATGG + Intronic
1129706981 15:77799952-77799974 CAAGGCCCTGAGAGGTGGCCAGG + Intronic
1130229525 15:82086087-82086109 CACAGCTCTCAGAACAGGCCAGG + Intergenic
1132582828 16:693396-693418 CTCAGGCCTGGGAAGAGGCCTGG - Exonic
1132976807 16:2715257-2715279 GAAAGCCCTGAGCAGAGGCCAGG - Intronic
1133108409 16:3530309-3530331 TACAGACCTGAGAAGTGAGCAGG - Intronic
1133322888 16:4925170-4925192 CAGAGCCCAGAGAAGGGGCTGGG + Intronic
1133337477 16:5015397-5015419 CTCAGCTCTGGGAAGTGGGCTGG - Exonic
1135037941 16:19093955-19093977 CACAGCCCTGACACGAGGGCAGG + Intergenic
1135266436 16:21030356-21030378 CCAAGCCATGTGAAGTGGCCTGG + Intronic
1137275968 16:46933704-46933726 GACAGCACTGAGAAGTGGTCAGG - Intergenic
1137670644 16:50276286-50276308 CACAGACCAGAGTAGGGGCCGGG + Intronic
1138477880 16:57282946-57282968 CACAGCCATGAGCAGCTGCCTGG - Intronic
1138510573 16:57506406-57506428 CACAGACCTGACAGGTGCCCTGG + Intergenic
1139034263 16:62924134-62924156 CACAGCCATGAGGAGTGTCAAGG - Intergenic
1141090501 16:81127114-81127136 TACAGCCCTAAGAAGTGACTTGG - Intergenic
1142033015 16:87847739-87847761 CACAGCCGTGAGCAGTGGGCAGG - Intronic
1142126631 16:88413840-88413862 CACAGCCCTGGGGGCTGGCCCGG - Intergenic
1142202011 16:88765556-88765578 CACTGCCCGGACACGTGGCCAGG + Intronic
1143204082 17:5131053-5131075 AACAGCCCTGAGACTGGGCCAGG - Intronic
1143782716 17:9237820-9237842 TCCAGCCCAGAGAAGTGGCTGGG - Intronic
1144373909 17:14620052-14620074 CACAGCCCTCAGAAGAAACCAGG + Intergenic
1146055505 17:29578815-29578837 GAGAGACCTGAGAGGTGGCCAGG + Intronic
1147262172 17:39214959-39214981 CGCAGCTCTGAGGAGGGGCCTGG - Exonic
1147267640 17:39244488-39244510 CAGAGAGCTGAGAGGTGGCCGGG - Intergenic
1148744572 17:49911235-49911257 CAAAGGCCGGAGAAGTGGCTTGG + Intergenic
1151335077 17:73434956-73434978 AACAGCTCTGGGAAGCGGCCAGG + Intronic
1151555378 17:74843850-74843872 CAACGTCCTGAGAAGTGGCATGG - Intronic
1151736121 17:75941294-75941316 GTCAGCCCTCAGAAGTGGGCAGG - Intergenic
1151757534 17:76083239-76083261 TACAGCCCAGAGATGTGGCAGGG - Exonic
1152003598 17:77662904-77662926 CACAGCCCTGAGTAGCAGGCAGG + Intergenic
1152284793 17:79406024-79406046 CACAGCCATGAAAAGGGGCAAGG - Intronic
1153041044 18:812741-812763 CCCAGCTCTCAGTAGTGGCCAGG + Intergenic
1153088539 18:1317912-1317934 CACAGCACTAAGACGTGCCCAGG - Intergenic
1153744755 18:8166199-8166221 CCCAGCTCTGAGAAGTGGCTTGG + Intronic
1154392545 18:13952787-13952809 CCCAGCCCTGACATATGGCCTGG + Intergenic
1155450119 18:25954259-25954281 CCCAGCCCTAAGAAGTGACAAGG + Intergenic
1156315268 18:35963572-35963594 CAGAGATCCGAGAAGTGGCCAGG - Intergenic
1156658645 18:39318662-39318684 GACAGCCCTGAAATGTGCCCAGG + Intergenic
1157675044 18:49562431-49562453 CCCAGCACAGAGAAGTGGCTGGG - Intronic
1158871149 18:61689417-61689439 CACATCGCTGAGAAGGGGTCAGG + Intergenic
1159861942 18:73659957-73659979 CCCAGCCCTGAGAACTGGCCCGG + Intergenic
1160605117 18:80044433-80044455 CACAGGCCTGTGCTGTGGCCTGG + Intronic
1161321797 19:3644799-3644821 CACAGCACTGAGGACAGGCCTGG - Intronic
1161434846 19:4257076-4257098 CACAGCACTGGGAAGCAGCCAGG + Intronic
1161585483 19:5103178-5103200 CAGAGAGCTGAGGAGTGGCCAGG - Intronic
1161958867 19:7511984-7512006 CACAGGACTGAGAGATGGCCAGG - Intronic
1162017944 19:7855896-7855918 CCCTGCCCGGAAAAGTGGCCTGG + Intronic
1162641132 19:12011107-12011129 AAAAGCCCTGAGAACCGGCCAGG - Intergenic
1162898822 19:13781801-13781823 CCCAGCCCTGAACAGAGGCCGGG - Intergenic
1163379019 19:16952103-16952125 CTAAGCCCTGAGAGGTGGACAGG + Exonic
1163916326 19:20243842-20243864 ACCAGCCCTGGGGAGTGGCCAGG - Intergenic
1163935740 19:20441526-20441548 CACAGGCCTGACATGGGGCCAGG + Intergenic
1164415632 19:28044694-28044716 CACAGCCCTGAGCAATGAGCAGG + Intergenic
1164673177 19:30084703-30084725 CACAGCCCTGGGAAGAAGTCAGG - Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1166022720 19:40047282-40047304 CACACCCCTGAGATGTGGTTTGG - Intronic
1166867392 19:45848174-45848196 GACAGGACTGAGTAGTGGCCAGG + Intronic
1167096565 19:47377748-47377770 CCCAGCTCTGAGAAGTCCCCAGG - Intronic
1167170033 19:47824763-47824785 CACAGCTCTGAGAATCAGCCTGG + Intronic
1202715112 1_KI270714v1_random:38109-38131 CAGAGCCCTGAGCACAGGCCTGG + Intergenic
924965559 2:73407-73429 CAGCACCCTGAGAAGTGCCCCGG + Intergenic
925823991 2:7828791-7828813 CAAAGGTCTGAGAGGTGGCCAGG - Intergenic
926013479 2:9426999-9427021 CACTGCCCTGGGAGGTGGTCTGG + Intronic
927243228 2:20936628-20936650 TGCAGCCCTTGGAAGTGGCCTGG - Intergenic
929996058 2:46826848-46826870 AACAGCCCTGAGATGTGGATAGG - Intronic
932342460 2:70974937-70974959 TACACCCCAGAGAAATGGCCAGG - Intronic
932592584 2:73076082-73076104 CATAGCCCTGAGCAGTGGGCTGG - Exonic
934556746 2:95290624-95290646 GAAAGCCCTTAGCAGTGGCCTGG + Exonic
934922833 2:98359733-98359755 CAGAGCCTGGAGATGTGGCCAGG - Intronic
935040278 2:99419767-99419789 CCAAGCCCTGAGAAGGGGCAGGG + Intronic
935657517 2:105437751-105437773 CACAGTCCTGAGTAATGCCCTGG - Intronic
937210087 2:120262918-120262940 CACTGCCCTGAGACGTAGGCAGG + Intronic
938056166 2:128216376-128216398 CACAGCTCTTAAAAGTGGCATGG - Intergenic
938137506 2:128771021-128771043 CACAGCCCTGCAAGATGGCCTGG - Intergenic
939728748 2:145755378-145755400 CACAGCCCTGAGACCTTGACAGG + Intergenic
940318472 2:152349128-152349150 TAAAACCCTTAGAAGTGGCCGGG - Intronic
940458656 2:153934817-153934839 CACAGTTATGAAAAGTGGCCTGG + Intronic
942258029 2:174126600-174126622 CACAGACCTGGTAAGTGGCTAGG - Intronic
945990074 2:216388666-216388688 CCCAGCCCAGAGAAGTCACCTGG + Intergenic
946904057 2:224399008-224399030 TTCACACCTGAGAAGTGGCCAGG + Intronic
947076893 2:226354770-226354792 CACAGCACTAAGCAGGGGCCTGG - Intergenic
947586718 2:231361055-231361077 CACAGCCCTCCGAGGTGGTCAGG - Intronic
947858118 2:233338258-233338280 CAGAGCTCAGAGAAGGGGCCTGG + Intronic
947860426 2:233354299-233354321 CACGGCCCGGAGAGGTGGGCGGG + Intergenic
948194818 2:236087431-236087453 TAGAGCCATGAGAAGTGGCTAGG - Intronic
948910827 2:241001827-241001849 CAGAGCCCTGAGCAGAGGCAGGG + Intronic
1168741977 20:199900-199922 CAGGGCCTTGAGAAGTAGCCAGG - Intergenic
1171356254 20:24547653-24547675 CACATACCTGGGAAGAGGCCTGG - Intronic
1172350124 20:34232231-34232253 GACAATCCTGAGAAATGGCCTGG + Intronic
1174199966 20:48800216-48800238 CACACCGCTGGGAAGTGGCAGGG + Intronic
1175696935 20:61109580-61109602 CTCAGCCATGAAAAGTGTCCAGG - Intergenic
1175717698 20:61266375-61266397 CACACTCCTGAAAAGAGGCCTGG - Intronic
1176053853 20:63134585-63134607 CACGGCCCGGAGAGGTGGCAGGG + Intergenic
1176734603 21:10533766-10533788 CACAACCCAGAGGAGTTGCCTGG - Intronic
1177145600 21:17403993-17404015 CACAGCCCTGTAAAGATGCCTGG - Intergenic
1177233936 21:18361464-18361486 AGGAGCCCTGAGAAGTGGTCTGG + Intronic
1177359048 21:20045556-20045578 CATTGCCCTGTGAAGTGCCCTGG + Intergenic
1178640066 21:34338303-34338325 CAAAGCCCAGAGACGTGACCTGG + Intergenic
1178776601 21:35557629-35557651 CACAGCTATGAGAAGTAGCCTGG + Intronic
1179564188 21:42236108-42236130 GTCAGCACTGAAAAGTGGCCAGG + Intronic
1180254082 21:46610754-46610776 AACAACTCTGAGAAGTGACCTGG + Intergenic
1180848039 22:18995100-18995122 CGCAGCCCTGGGGAGGGGCCAGG - Intergenic
1181043155 22:20202408-20202430 CACAGACCCCAGGAGTGGCCAGG - Intergenic
1181550583 22:23636965-23636987 CAGAGCCCTCAGAAGGAGCCTGG + Intergenic
1181590469 22:23881658-23881680 AACAGCCCTGAGAAATGTCAGGG + Intronic
1181602436 22:23960466-23960488 CACAGCCCTGAGAAACAGCAAGG + Intronic
1181606077 22:23980841-23980863 CACAGCCCTGAGAAACAGCAAGG - Intronic
1181814700 22:25429480-25429502 CAGAGCCCTGAGAAGGGGGCAGG - Intergenic
1182623902 22:31632218-31632240 CACAGCCCTGGGATGCGGCAGGG + Intronic
1182737728 22:32543000-32543022 CAGAGCCCTGTGGAGTGGCCGGG + Intronic
1182801843 22:33038148-33038170 CTGAGCCCTGGGAAGTGGCTGGG + Intronic
1182836704 22:33348068-33348090 CACAGCCCAGAGAGGAAGCCAGG + Intronic
1183121860 22:35736330-35736352 CACAACCCCCAGAAATGGCCTGG + Intergenic
1183420607 22:37709470-37709492 CACAGCCCGGAGTCGGGGCCTGG + Intronic
1183515635 22:38264280-38264302 CAGAGCCCTGAGAAGGGTCAAGG - Intronic
1183732282 22:39625310-39625332 CAAAGCCATGAGGAGTGGGCTGG + Intronic
1183752759 22:39731440-39731462 CACAGCTCTGAGCAGTGGGCTGG - Intergenic
1184669213 22:46004073-46004095 CACAGCACTGAGACCTAGCCAGG - Intergenic
1184669517 22:46005473-46005495 CACAGCCTCTGGAAGTGGCCTGG + Intergenic
1184965917 22:47972206-47972228 CACAGCTCTGAGAGGTGGCTTGG - Intergenic
1185188660 22:49418710-49418732 CGCATCCCTGAGAAGTGAGCTGG - Intronic
950407937 3:12816215-12816237 GTCAGCCCTGACCAGTGGCCAGG - Intronic
950855306 3:16099067-16099089 CACAGGCCTGAGGAGAGACCTGG + Intergenic
951222290 3:20081456-20081478 CACAGCACTGAGAGGTGCCAAGG + Intronic
951575098 3:24105351-24105373 CACAACCCTGACAAATAGCCTGG + Intergenic
954417931 3:50403178-50403200 CACAGCCCTGGGAGGGGCCCTGG - Intronic
954628318 3:52034932-52034954 CACAGGCCTGGGCAGTGGCCTGG + Intergenic
954630562 3:52045575-52045597 GACAGCCCTGGGAAGGGGGCTGG + Intergenic
954705385 3:52477714-52477736 CGCAGCCTTGGGAATTGGCCAGG + Intronic
957132787 3:76243509-76243531 CAAAGGCCTGAGAAGCAGCCGGG + Intronic
959591037 3:108081703-108081725 CACAGTTCTGTGAAGTAGCCCGG - Intronic
960618291 3:119615894-119615916 CACAGCACTTAGAAGTGACGTGG + Intronic
960679099 3:120228212-120228234 CACAACCCTGAGAAATGGCCTGG - Intronic
960970536 3:123136362-123136384 ACCAGCCCTGAGAAGGGGCACGG - Intronic
962479464 3:135785950-135785972 CAGAGCCCAGAGAGATGGCCTGG + Intergenic
962865405 3:139444378-139444400 CACACCCCTAAGAAGTGACAGGG - Intergenic
962878301 3:139552933-139552955 CAGAGCACAGGGAAGTGGCCAGG - Intergenic
963901056 3:150733916-150733938 AATAGCCCTGAGAAGTGGATGGG + Intergenic
964124796 3:153225128-153225150 AAAAGCCTTGAGAACTGGCCGGG + Intergenic
965838453 3:172877081-172877103 CACAGCCCTGCGCAGTAGGCAGG - Intergenic
966729875 3:183141879-183141901 CACAGCCCTAAGAGGTGGCAGGG + Intronic
966748106 3:183297366-183297388 GACTTCCCTGAGAAGTGGACAGG - Intronic
967983903 3:195081369-195081391 CACAGCGCTGAGCAGGGCCCGGG + Intronic
968735853 4:2296235-2296257 CAAGGCCCTGAGTGGTGGCCTGG - Intronic
973543788 4:51959998-51960020 CATAACCCTGAGGAGTGGCCAGG - Intergenic
978359678 4:107916932-107916954 TACAATCCTGAGAAATGGCCTGG - Intergenic
979571583 4:122232788-122232810 CACAACCCTGTGAAATAGCCTGG + Intronic
982012006 4:151114617-151114639 CACAGCCCTGAGAAGTGGCCAGG - Intronic
982207369 4:153006617-153006639 TACCTCCCTGAGAAGTGGTCAGG + Intergenic
984885580 4:184446415-184446437 CACAGCCCTGTGCAGGGGCTGGG + Intronic
985781126 5:1872360-1872382 CAGAGCCCAGAGCAGGGGCCAGG - Intergenic
985912365 5:2894487-2894509 ATCAGCCCTCAGAAGAGGCCTGG + Intergenic
986436813 5:7742251-7742273 CATAGCTCTGAGATGTGGGCTGG + Intronic
986724221 5:10582160-10582182 CACAGGCCTGTGAACTGGACAGG - Intronic
988973280 5:36490737-36490759 CTCAGCCCTGCGGAGTGGCTAGG - Intergenic
990347352 5:54883820-54883842 CTCGGCCCTGCGAAGTGGCTGGG - Intergenic
995168955 5:109083696-109083718 TACATCCCTGAGAAATGGCCTGG - Intronic
996790037 5:127282525-127282547 CACAGCGCTGCGAATTGGTCAGG - Intergenic
998185293 5:139974711-139974733 CAGAGGCCTCAGAAATGGCCTGG + Intronic
998390837 5:141786128-141786150 CTGAGACCTGAGAAGTGGCATGG + Intergenic
999323157 5:150626990-150627012 CACAGCTCTGGGAGGTGGGCAGG + Intronic
1001202511 5:169731166-169731188 CACAGCATTGAGAAGTGGCAAGG - Intronic
1001477510 5:172061064-172061086 CCCAGCCCTGGGAAGTGGGGTGG - Intronic
1001512122 5:172331286-172331308 CTCCACCCTGAGAAATGGCCGGG - Intronic
1002910468 6:1487427-1487449 CCCAGCACTGAGAAGGGGCCAGG + Intergenic
1005694797 6:28341837-28341859 AACAACCCTGAGAAATGGCGTGG + Intronic
1006151796 6:31993843-31993865 CACAGCACAGAGAAAAGGCCGGG - Intronic
1006158097 6:32026581-32026603 CACAGCACAGAGAAAAGGCCGGG - Intronic
1006924459 6:37646934-37646956 CACAGCTCTGAGAATTGGGCAGG - Intronic
1008408797 6:51148825-51148847 CACAGTGTTGAGAAATGGCCGGG - Intergenic
1010158596 6:72824967-72824989 AACAACCCAGAGAAGTGGGCAGG + Intronic
1012452381 6:99366312-99366334 AACAGCCCTGAGAAGTAGGTAGG + Intergenic
1013193049 6:107820175-107820197 CTCAGCCAAGAGACGTGGCCAGG - Intronic
1013470706 6:110461279-110461301 CACAGACCTCAGGAGTGGCCAGG + Intronic
1014560593 6:122885262-122885284 CATAGCCCTGAGCAGGGCCCAGG - Intergenic
1015854698 6:137611073-137611095 CACAACCCTGGGAAGTGTCCTGG + Intergenic
1016750401 6:147625168-147625190 CCCAGGCCTGAGAAGGGCCCAGG + Intronic
1017878695 6:158544746-158544768 CACAGCCCTGAGGCGTGGGCAGG - Intronic
1018756118 6:166851125-166851147 CTCAGCCCTGGGAAGTGGGCAGG - Intronic
1019565244 7:1675797-1675819 CACAGCCCGAAGTAGTGGCTGGG + Intergenic
1019801945 7:3094415-3094437 CATGCCCCTGGGAAGTGGCCGGG + Intergenic
1021358191 7:19680388-19680410 CAAAGACATGAGGAGTGGCCTGG - Intergenic
1022274931 7:28846064-28846086 CACAGCCCTGGAATGTGGGCGGG + Intergenic
1022496211 7:30854750-30854772 CACAGCCCTGGGAAATGATCAGG + Intronic
1024845392 7:53636195-53636217 CAAAGCATTGAGATGTGGCCTGG + Intergenic
1025605717 7:63038636-63038658 CTGAGCCCTGAGGAGAGGCCTGG + Intergenic
1026107840 7:67434945-67434967 AAAAGCCCTCAGAATTGGCCAGG - Intergenic
1027150246 7:75728475-75728497 CACAGCCTTGTGCAGTGGGCTGG - Intronic
1027826011 7:83117488-83117510 CACATGCTTGAGAAATGGCCAGG - Intronic
1029696665 7:102218067-102218089 CACACCCCTGTGCTGTGGCCAGG + Intronic
1030838064 7:114312868-114312890 CACAACCCTGATAAATGGCCTGG + Intronic
1031127463 7:117791284-117791306 CACCCACCTGAGACGTGGCCAGG + Exonic
1031173564 7:118320862-118320884 CATAGCCCTGAAAAGCTGCCTGG + Intergenic
1031584872 7:123522102-123522124 CAGAACCCTGAGAAATGGTCTGG - Intronic
1031943322 7:127812761-127812783 CACAACCCTGATAAATAGCCAGG - Intronic
1031975375 7:128090255-128090277 ATCAGCCCTGAGAAGTGGCAAGG - Intronic
1033180979 7:139177925-139177947 CAAAGCCCTGAAAAATGACCTGG + Intronic
1034964189 7:155381665-155381687 CCCAGCCCTGCCAAGTGGCGTGG + Intergenic
1035713077 8:1733445-1733467 CACAGCCCTGAGAGATGGTCCGG + Intergenic
1035868778 8:3113660-3113682 GACATCCCTGAGAAGTGGGAAGG + Intronic
1036824114 8:11963110-11963132 CACAGCTCTGAGTAGTGTCCTGG + Intergenic
1037103018 8:15071496-15071518 CATAGCCCTGTGAAGTAGGCAGG - Intronic
1039870912 8:41544316-41544338 CACAGTCCTGAGAAGCGGGCAGG + Exonic
1039948986 8:42153189-42153211 CGCAGCCCTGAGAGGCCGCCCGG - Intronic
1040544060 8:48383203-48383225 CACATCCCTGAGCTGTGCCCTGG - Intergenic
1042533991 8:69840699-69840721 CACAACTCTGAGAAACGGCCTGG - Intergenic
1047340571 8:123976652-123976674 AACAGCTCAGAGAAGTAGCCAGG - Intronic
1048016095 8:130499035-130499057 CACAGCCCTGAGCAGGTGCATGG - Intergenic
1048111028 8:131469088-131469110 CAGAGCCATGAGAACTGGCTGGG + Intergenic
1048328373 8:133455646-133455668 CTCACCCCTGAGAAGAGCCCCGG - Exonic
1049031647 8:140042629-140042651 CACGGCCCTGTGGAGTGTCCGGG + Intronic
1049588175 8:143441409-143441431 CAGAGCCCTGAGCCATGGCCTGG - Intronic
1051243008 9:15080177-15080199 CACAACCTTGGGAAATGGCCTGG + Intergenic
1052738602 9:32371818-32371840 CACAACCCTGAGAAATGGCCTGG + Intergenic
1053052126 9:34970879-34970901 AACATCCCTGTGAAGTGGGCTGG + Intronic
1053791462 9:41689129-41689151 CACAGCCCTGGGACCTGGTCAGG + Intergenic
1054153698 9:61625642-61625664 CACAGCCCTGGGACCTGGTCAGG - Intergenic
1054473479 9:65556761-65556783 CACAGCCCTGGGACCTGGTCAGG - Intergenic
1055321488 9:75087743-75087765 CGCAGCCTGGAGAAGTCGCCAGG - Intronic
1057274806 9:93670565-93670587 CAGGGCCCTGTGAAGAGGCCAGG + Intronic
1057696781 9:97328758-97328780 CAGAGCTCTGAGAGGTGGCAGGG - Intronic
1057804752 9:98212090-98212112 GAAATCCCTGAGAAGGGGCCAGG - Intronic
1057967411 9:99517692-99517714 CACAGGCCTGTGAAGGGGCTTGG - Intergenic
1058005089 9:99906239-99906261 AAAAGCCCTGTGAAGTGGACAGG - Intergenic
1058014987 9:100021160-100021182 CACAACTCTGAGAAATGGCCTGG - Intronic
1058135379 9:101301913-101301935 CACAGCACTGAGAAGAGGCAAGG - Intronic
1058651219 9:107177134-107177156 CACAGCCCGGAGTAGAGGCCAGG - Intergenic
1058987152 9:110219042-110219064 CAGAAGCCTGTGAAGTGGCCTGG + Intergenic
1059345956 9:113628120-113628142 CAGTGGGCTGAGAAGTGGCCTGG - Intergenic
1059973336 9:119690138-119690160 CTCCTCCCTGAGAAGTTGCCAGG + Intergenic
1060258072 9:122050153-122050175 AACAGCCCTGGGAGGTGGACAGG - Intronic
1060422502 9:123479493-123479515 CACAGCCCTGAAAGATAGCCTGG + Intronic
1060885089 9:127145777-127145799 CACAGACCTGGTAAGTGGCAGGG - Intronic
1060985540 9:127817064-127817086 GGCAGCCCTGAGAAACGGCCTGG - Intronic
1061359641 9:130132883-130132905 CACTGCCCTGGGAAATGTCCTGG + Intronic
1061960032 9:133983223-133983245 CACAGCCCACAGACATGGCCTGG + Intronic
1062025374 9:134337919-134337941 GCCAGCCCTGAGAGGTGGCGGGG + Intronic
1062115142 9:134804694-134804716 CACGACTCTGAAAAGTGGCCAGG + Intronic
1062287792 9:135780811-135780833 CCCAGCCCTGGGGAGCGGCCCGG - Intronic
1187523653 X:20035140-20035162 CTCAGCCCTTAGAAGAGGGCTGG + Intronic
1189990160 X:46586490-46586512 CACAGAGCTGGGAAGTGACCTGG - Intronic
1190047622 X:47125341-47125363 CACAACCCTGAGAAATGGCTGGG + Intergenic
1191849583 X:65576156-65576178 AACTGCCCTGGGAAGTGGGCAGG - Intergenic
1192234144 X:69285500-69285522 CACAGCCCTGGGAAGAGGCAGGG + Intergenic
1196126724 X:112109314-112109336 CACAGCTCTTAAAAGTGGCCTGG + Intergenic
1198026484 X:132712588-132712610 CACAGTCCTGAGAGGTGGTGTGG + Intronic
1198261852 X:134972098-134972120 CACAACCCTGATAAATGGCCAGG - Intergenic
1198513081 X:137373950-137373972 AACAGCCCTGAGAAATGGGCAGG + Intergenic
1199680060 X:150217976-150217998 CACCACCCTGAGAAGAGGCAGGG - Intergenic
1199848753 X:151710413-151710435 CACAGCCCTGAGAAGCTGCATGG - Intergenic
1201073672 Y:10171198-10171220 CACTGGCCTGGGCAGTGGCCAGG - Intergenic
1202592636 Y:26503279-26503301 CACAACCCAGAGGAGTTGCCTGG - Intergenic