ID: 982013471

View in Genome Browser
Species Human (GRCh38)
Location 4:151129304-151129326
Sequence CAGCTCTGCCAATTTGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982013466_982013471 15 Left 982013466 4:151129266-151129288 CCAGGCACATTAGAGAAAGGTTT 0: 1
1: 0
2: 1
3: 14
4: 152
Right 982013471 4:151129304-151129326 CAGCTCTGCCAATTTGGGATGGG 0: 1
1: 0
2: 0
3: 18
4: 166
982013465_982013471 16 Left 982013465 4:151129265-151129287 CCCAGGCACATTAGAGAAAGGTT 0: 1
1: 0
2: 0
3: 10
4: 138
Right 982013471 4:151129304-151129326 CAGCTCTGCCAATTTGGGATGGG 0: 1
1: 0
2: 0
3: 18
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982013471 Original CRISPR CAGCTCTGCCAATTTGGGAT GGG Intronic
901786652 1:11629381-11629403 CATCTGGGCCAATGTGGGATGGG + Intergenic
904591983 1:31620057-31620079 CACGTCTGCCCCTTTGGGATTGG - Intronic
904910870 1:33933227-33933249 CTGCTCTGCCAACTTAGGTTGGG - Intronic
905887994 1:41501992-41502014 CAGCTCTGCCTTTTTAGGAAAGG - Intergenic
908316347 1:62936553-62936575 TAGCTCTACCAACTTGGGACTGG - Intergenic
910028871 1:82691122-82691144 CAGTTCTACCAATTTTGCATGGG - Intergenic
910115970 1:83732078-83732100 CAGCTCTGCCTAGTGGGAATGGG - Intergenic
910221046 1:84889744-84889766 CAGCTCTGGCTATTGGGGGTTGG - Intronic
910289728 1:85588478-85588500 CAGCTCAGCCACAGTGGGATAGG + Intergenic
916501620 1:165392464-165392486 TGGCTCTGCAAATTTGGGAAGGG + Intergenic
918256138 1:182749667-182749689 CAGCTCTACCATTTTCTGATGGG + Intergenic
918718064 1:187817644-187817666 CAGCTCCTCCAATTTGGAACAGG - Intergenic
918989988 1:191685492-191685514 CAGCTCAGCCACAGTGGGATAGG - Intergenic
919980764 1:202641950-202641972 CAGCCCTGCTACTTTGGGATGGG + Intronic
922672470 1:227521590-227521612 CAGCTCAGCCTGTTTGGGTTTGG - Intergenic
1064526618 10:16263477-16263499 CAGCTGTGCAATATTGGGATTGG - Intergenic
1066218378 10:33310953-33310975 CAGCTCTGACTTTTTGGAATTGG - Intronic
1067104040 10:43353244-43353266 CAGGTGTGCCAATTTAGGACTGG + Intergenic
1070201307 10:74208261-74208283 CAGCCCTGCCAACTTGGAAGTGG + Intronic
1070332884 10:75430896-75430918 CAGCTCTTCCAGGTGGGGATGGG + Intergenic
1071553761 10:86586648-86586670 CAGCTGTGCCAAAAGGGGATAGG + Intergenic
1071573145 10:86708890-86708912 CAGCTCTGCCCAGCAGGGATCGG + Intronic
1074187227 10:111107680-111107702 CAGTTCTCCCACTTTGGGTTTGG + Intergenic
1077143538 11:1035170-1035192 CATCTCTGCCAACATGGGAGGGG - Intronic
1080030492 11:27655898-27655920 CACCTCTGCCATTTTGGGTTAGG - Exonic
1080323807 11:31046814-31046836 CAGTTCTGCCAGTTTGAGAATGG - Intronic
1083886998 11:65577735-65577757 CATCGCTGGCAATTTGGGCTTGG + Intronic
1087650205 11:100857522-100857544 TAGTTCTGCCAATGTGAGATGGG + Intronic
1090639218 11:128716343-128716365 CAGCTCTGGCATTATGGGCTGGG - Intronic
1091105734 11:132917775-132917797 CATCTCTGCCTCTTTGGGCTGGG + Intronic
1093525839 12:20102615-20102637 CCGCTCTGCCAATTGGGTAGGGG + Intergenic
1094812140 12:34148810-34148832 CAGCTCAGCCTGTTTGGGTTTGG + Intergenic
1095181760 12:39154357-39154379 CAGCTCAGCTACTGTGGGATAGG - Intergenic
1096603399 12:52746721-52746743 GAGCTCTGCCAACTTGGCCTGGG + Intergenic
1097426079 12:59446243-59446265 CAGCTCAGCCACTGTAGGATAGG - Intergenic
1100615766 12:96230723-96230745 CAGCACTGCCAATCCGGGATTGG - Intronic
1104070069 12:125336851-125336873 CAGCTCTGCCACTGTGTGATTGG - Intronic
1106882073 13:34142672-34142694 CAGCTCTACCAATAAGGGAATGG + Intergenic
1108228731 13:48317231-48317253 CAGCTCTTCCATTTTGGAAAGGG - Intronic
1109513705 13:63413497-63413519 CAGCTCTTAGAATTTGGGAAGGG - Intergenic
1109583637 13:64371358-64371380 CAGCTCAGCCACTGTAGGATAGG - Intergenic
1109887404 13:68559687-68559709 TAGCTCTTCCATTTTGGTATAGG + Intergenic
1111300404 13:86342125-86342147 CAGCTCAGCCACATTGGAATAGG - Intergenic
1113730185 13:112636288-112636310 CAGTTCTTCCAATTCTGGATTGG - Intergenic
1116354831 14:43914828-43914850 CAGCTCAGTCAATGTGGGGTAGG + Intergenic
1117936773 14:60915695-60915717 CTGCTTTGCTAATTTGTGATGGG + Intronic
1119028085 14:71169577-71169599 CAACTCAGCTAAGTTGGGATGGG - Intergenic
1120100268 14:80436278-80436300 TATCTCTGTCACTTTGGGATTGG - Intergenic
1122050454 14:99055892-99055914 CAGTTCTGTCAATTTGGGCCAGG + Intergenic
1124496459 15:30190702-30190724 CAGCCCTGCTACTTTGGGATGGG + Intergenic
1124747116 15:32347946-32347968 CAGCCCTGCTACTTTGGGATGGG - Intergenic
1128749357 15:70137982-70138004 GAGCTCAGCCAATATGGGAGCGG + Intergenic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129875364 15:78971982-78972004 CAGCTCTGCAAAGTTGGGGGTGG - Intronic
1131370014 15:91872576-91872598 TAGCTGTGCCAACTTGGGCTTGG - Intronic
1131781252 15:95862363-95862385 CAGCTCTGCCAATTTCTACTTGG + Intergenic
1132881220 16:2162529-2162551 CAGCTCCGCCACTTTGGCCTGGG + Intronic
1133823267 16:9255854-9255876 CAGCTCTGCCACCTTGGAATTGG + Intergenic
1133998316 16:10763713-10763735 CAGCTCTGCCGAGATGGGATTGG + Intronic
1134096329 16:11421219-11421241 CAGCTCTGCCCACTGGGGCTGGG - Intronic
1135852928 16:25980920-25980942 CAGCTCAGCAAGTTTAGGATTGG + Intronic
1138453466 16:57107156-57107178 CAGCTGTGCCAAGTTGGGGTGGG - Intronic
1138538920 16:57676451-57676473 CAGCTCTGCCAATTGGGACGTGG - Intronic
1138775684 16:59721061-59721083 TACCTGTGCCAATTTGGGCTGGG - Intronic
1140521643 16:75586957-75586979 CAGCTCTGCCCACTTGGCAATGG - Intergenic
1141162037 16:81635768-81635790 CAGCTCTGCCCATTTGGGGGAGG + Intronic
1142476859 17:193900-193922 CAGCTCTGCGAATGTGGAAACGG + Intergenic
1143081111 17:4382062-4382084 CAGCACTGCCATTTGGGGAAAGG - Intergenic
1143778066 17:9212538-9212560 CAGCTCTGTCCATTTCGGCTGGG - Intronic
1144531139 17:16040394-16040416 CTGCTGTGCCAATTTTGTATTGG + Intronic
1145117307 17:20223806-20223828 CATCTCTGTCACTCTGGGATTGG + Intronic
1145982247 17:29019958-29019980 CCGCGCTGCCCATTTGCGATCGG + Intronic
1148575949 17:48711363-48711385 CAGCTCTGAGAAATTTGGATGGG - Intergenic
1151108904 17:71652365-71652387 CAGCTCTGCTGATTTTGGCTTGG - Intergenic
1151694226 17:75705862-75705884 CTGCTCTGCCCATCTGGGGTAGG - Intronic
1156650759 18:39224334-39224356 AAGATCTGATAATTTGGGATTGG - Intergenic
1158220883 18:55149618-55149640 CAGCTCTGCCTCTTTGGTGTTGG + Intergenic
1158338369 18:56437776-56437798 CAGCTCTCCAATTTTGTGATTGG - Intergenic
1159261691 18:66021701-66021723 CATCTGTGCCAACTTGCGATTGG + Intergenic
1159305621 18:66638519-66638541 CAGTGCTGGCAAATTGGGATAGG - Intergenic
1159779637 18:72646059-72646081 CATCTCTGCCATCTGGGGATGGG + Intergenic
1160028147 18:75235888-75235910 CAGCTCTTCCATTCTGAGATGGG + Intronic
1161085298 19:2332414-2332436 CAGCTCTGCCAAGCTAGGACTGG - Intronic
1163216825 19:15885290-15885312 CATCTCTGCCCATGTGGGCTGGG + Intronic
1163748879 19:19063848-19063870 CACCTCTGCCAATCAGCGATTGG + Intergenic
1164426964 19:28150216-28150238 CAGCACTGCCAAGCGGGGATGGG + Intergenic
1164733367 19:30522229-30522251 CAGCTCTGCCAATCAGGCACAGG - Intronic
1168288132 19:55344574-55344596 GAGCTGTGCCAATTTGGGCAGGG + Intronic
927347962 2:22069686-22069708 CAACTCAGCCAAAGTGGGATAGG + Intergenic
928495689 2:31829295-31829317 CAGCTCAGCCACTGTAGGATAGG - Intergenic
931807966 2:65826470-65826492 CAGCTTTGCAAATTCGAGATTGG + Intergenic
945200547 2:207277031-207277053 CAGGTATGCCGATTTGGGAAGGG - Intergenic
945771225 2:214045196-214045218 CAGCTCTGCCAGAGTAGGATAGG + Intronic
947461241 2:230306444-230306466 CTGCCCTGCCAATTTGGGAGAGG - Intronic
948575622 2:238947544-238947566 CACCTCTTCCAAGTTGGGATGGG - Intergenic
948792741 2:240387823-240387845 CAGCTCTGGGACTCTGGGATTGG - Intergenic
1170597536 20:17817110-17817132 CAGCTAAGCCAACGTGGGATTGG + Intergenic
1174425595 20:50429880-50429902 CAGATCTGCCAATCTGGGGAAGG + Intergenic
1175147359 20:56907058-56907080 CAGCTCTTCCAACCTGGGCTGGG + Intergenic
1175986079 20:62764767-62764789 CAGCTCTGCCACTGTGAGCTGGG + Intergenic
1177129685 21:17240875-17240897 CAGCTTTGCCAAGCTGTGATGGG - Intergenic
1178817754 21:35946848-35946870 CACCTCTGCCAATTAGGCAAAGG - Intronic
1180185432 21:46136923-46136945 CAGCTCTGCCCTCTGGGGATGGG + Intronic
1180763130 22:18223771-18223793 CAGCTCTTCCACTTTGGAAAGGG + Intergenic
1180772515 22:18400776-18400798 CAGCTCTTCCACTTTGGAAAGGG - Intergenic
1180803895 22:18650392-18650414 CAGCTCTTCCACTTTGGAAAGGG - Intergenic
1180806868 22:18719057-18719079 CAGCTCTTCCACTTTGGAAAGGG + Intergenic
1181217823 22:21344867-21344889 CAGCTCTTCCACTTTGGAAAGGG + Intergenic
1181331783 22:22098474-22098496 TAGCTCTCCCAATTTTGGAGTGG - Intergenic
1181623749 22:24108207-24108229 CAGATCTGCCACTTAGGGGTTGG - Intronic
1185288816 22:50014117-50014139 CAGCTCAGCCAGCCTGGGATAGG - Intergenic
1203234353 22_KI270731v1_random:141764-141786 CAGCTCTTCCACTTTGGAAAGGG - Intergenic
954138438 3:48593034-48593056 CAGCACTGCCAAGTGGGGATTGG + Intronic
958682843 3:97353305-97353327 CAGCTCGGCCACAGTGGGATAGG + Intronic
960378106 3:116928031-116928053 CAGCTCTGCCAAACTGGGGTGGG + Intronic
960811259 3:121629587-121629609 CAGCTCACCCAGTTTGGGAAGGG - Exonic
962200287 3:133395566-133395588 CATCTCTGGCAACCTGGGATTGG + Intronic
962256949 3:133877678-133877700 CATCTCTGTCAGTTTGGGGTTGG - Intronic
965405225 3:168260086-168260108 CATCTCTGCCAATTTTGTATTGG - Intergenic
965692678 3:171374233-171374255 CAGTTTTGTCCATTTGGGATTGG - Intronic
967173707 3:186844030-186844052 CAGCTCTGCCTAATTCGGTTGGG + Intronic
968115909 3:196089512-196089534 GAGCTCTGCCACTTTGGAAGAGG + Intergenic
969853903 4:9983629-9983651 CAGCTCTGCCAATCTCTGCTGGG - Intronic
970322387 4:14887595-14887617 CAACTATACCAAATTGGGATGGG + Intergenic
974414958 4:61595154-61595176 CAGCTCAGCCACAGTGGGATAGG - Intronic
974697528 4:65395973-65395995 CTGCCCTGCCAATTTGGAAGGGG - Intronic
979145284 4:117239622-117239644 CTGCCCTGCCAACTTGGAATGGG - Intergenic
981836807 4:149064448-149064470 CAGCTCAGCCAAAGTAGGATGGG + Intergenic
982013471 4:151129304-151129326 CAGCTCTGCCAATTTGGGATGGG + Intronic
983061731 4:163168272-163168294 CAGCTCTACCATTTTGTGTTTGG + Intergenic
984208977 4:176822416-176822438 CATCTCTGCCACTTAGGAATTGG - Intergenic
984650378 4:182263849-182263871 AAGCTTTGCCAATTTGATATTGG + Intronic
985754400 5:1704557-1704579 CAGCTCTGCGCAGTGGGGATTGG - Intergenic
985944213 5:3164064-3164086 CGGCTCTGCCGATTTTGGCTGGG + Intergenic
987970615 5:24939272-24939294 CAGTTCTGCCTCTGTGGGATGGG - Intergenic
988376390 5:30440454-30440476 CATCTCTGTCACTCTGGGATTGG - Intergenic
989170224 5:38466214-38466236 CAGCTCTGCCAGTCTTGGTTGGG + Intergenic
991661369 5:68954075-68954097 CTAGTCTGACAATTTGGGATTGG + Intergenic
991945596 5:71895744-71895766 GAGCTGAGCCAATTTGGGAGTGG - Intergenic
994233843 5:97339198-97339220 CAGCTCAGCCACTGTAGGATAGG + Intergenic
995045354 5:107640667-107640689 CAGCCCTGTCAATTTGGAAGAGG + Intronic
998673898 5:144385681-144385703 CATTTTTGCAAATTTGGGATTGG - Intronic
999001944 5:147933531-147933553 CAGCTCTGCCACTTAGTGACTGG + Intergenic
999814962 5:155166788-155166810 CAGCTCTCCCACTTACGGATCGG + Intergenic
1001405920 5:171477526-171477548 CAGTTCTGACAGTTTGGGACAGG + Intergenic
1002951880 6:1821415-1821437 AAACTCTGCCAAGCTGGGATGGG + Intronic
1003153661 6:3573248-3573270 CAGCTCTGCAAAATTAGAATTGG + Intergenic
1006338617 6:33433631-33433653 CAGCTCTGGCAACATGGGAGGGG - Intronic
1007171099 6:39864312-39864334 CAGCTCTGCCCATGTCGGGTGGG - Intronic
1007919998 6:45598389-45598411 CTGCTCTTCTAATTTGGGAAGGG + Intronic
1011611635 6:89157346-89157368 CATCTCTGCCATTTTATGATTGG + Intronic
1012169662 6:96002424-96002446 CCGCCCTGCCAACTTGGGAGGGG + Intergenic
1021589228 7:22242437-22242459 AAGTTCTGCCAATATGGGGTGGG + Intronic
1022878888 7:34565301-34565323 CAGCTCTACCATTAAGGGATGGG + Intergenic
1023161960 7:37306051-37306073 CAGCTCAAACAATTTAGGATTGG + Intronic
1024248606 7:47489457-47489479 CAGCTAAGCCCATCTGGGATAGG - Intronic
1024560591 7:50641624-50641646 CAGCTGTGCAAAGTTGGGAGGGG + Intronic
1028652306 7:93162979-93163001 CAAATCTGCCAAATTGGGACTGG + Intergenic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1036758236 8:11486107-11486129 GAGCTGTGCCAGCTTGGGATTGG - Intergenic
1037974024 8:23196768-23196790 CAGCTCTGCAAATTGGGCTTAGG + Intronic
1039662063 8:39478517-39478539 CAGTTCTGGCAACATGGGATGGG + Intergenic
1041582914 8:59483442-59483464 CAGCTCAGCCACTGTAGGATAGG - Intergenic
1044412674 8:91901882-91901904 CTGCTCTGCCAACTTGGAAGGGG + Intergenic
1049742272 8:144246922-144246944 GGGCTCTGCCAATTTGGGTGAGG - Intronic
1050750596 9:8932607-8932629 CAGCTTTGCCAAGTTGTGGTGGG + Intronic
1051036665 9:12755200-12755222 CAGCACTGGCAGTTTAGGATTGG + Intergenic
1053295079 9:36906928-36906950 CAGCTCTGCCACTTATGAATTGG - Intronic
1053479431 9:38405043-38405065 GAGCTCTGCAAATGTGTGATGGG + Intergenic
1055604071 9:77949614-77949636 CAGCTCTGGAAAATTGGCATAGG + Intronic
1056468672 9:86884247-86884269 CAGCTCTGCCCAACTGGGATAGG - Intergenic
1057860504 9:98637062-98637084 CAGCTCTTCAAAGTTGGGATGGG - Intronic
1060864580 9:126985310-126985332 CAGCTCTGCCAGGTTGGCTTTGG - Intronic
1062232191 9:135487763-135487785 CAGCTCTTCCACTTTGGAAAGGG + Exonic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189595489 X:42560518-42560540 GAGCTCTGCCAATTTGAAACAGG - Intergenic
1192938904 X:75892551-75892573 CAGCTATGACCATTTGGGAAAGG - Intergenic
1195985595 X:110626721-110626743 CAGCTTTGCCAAGTTGCCATGGG - Intergenic
1196105203 X:111887981-111888003 CAGGACTGCCAAGTTGGGAGGGG + Intronic
1198274469 X:135088080-135088102 CTGCTCTGCCAAACTGGGAGAGG + Intergenic
1200606095 Y:5264601-5264623 CAGCTCAGCCAAAATAGGATAGG - Intronic
1200829629 Y:7678355-7678377 CAGCTCTGCCTGCTTGGGAGAGG + Intergenic
1201567725 Y:15384334-15384356 CAGCTCTTCCTCCTTGGGATGGG + Intergenic
1201757283 Y:17499882-17499904 CAGCTCAGCCTGTTTGGGTTTGG + Intergenic
1201844271 Y:18406100-18406122 CAGCTCAGCCTGTTTGGGTTTGG - Intergenic