ID: 982016505

View in Genome Browser
Species Human (GRCh38)
Location 4:151159657-151159679
Sequence TCTAGCACATAGATCTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982016505 Original CRISPR TCTAGCACATAGATCTTGGT TGG (reversed) Intronic
901300161 1:8194364-8194386 TCTAGCACGTACATCTTGTGTGG + Intergenic
905234194 1:36534574-36534596 TCTGGCACCTCGATGTTGGTAGG + Intergenic
907765200 1:57403082-57403104 TCTAGTCCATACATTTTGGTGGG + Intronic
909911829 1:81268810-81268832 TCCAGCACAGACATCTTAGTTGG - Intergenic
911160762 1:94680628-94680650 TCTAACACATAAATTTTGGAGGG + Intergenic
920688685 1:208129379-208129401 GCTACAACATAGAACTTGGTAGG - Intronic
922236023 1:223723373-223723395 ACTAGCAAATAGATGTTGGCTGG + Intronic
1066625955 10:37405594-37405616 TCTAGTACATAGTTCTGTGTGGG + Intergenic
1068906297 10:62327470-62327492 TACAGCACATAGATCTTGTTTGG - Intergenic
1071972699 10:90924149-90924171 TATGGCACATGGATCTGGGTGGG - Intergenic
1073486651 10:103823494-103823516 CCTAGCACATGGAACTTGCTAGG - Intronic
1082122720 11:48396705-48396727 CCTAGCACATAGTGCTTTGTAGG + Intergenic
1082251909 11:49991970-49991992 CCTAGCACATAGTGCTTAGTAGG - Intergenic
1084753072 11:71216795-71216817 TCTAGCACATACAATTTTGTAGG + Intronic
1087021958 11:93611865-93611887 TCTGGCCCATAAGTCTTGGTGGG + Intergenic
1087112777 11:94489248-94489270 TGGAGCACATTGATCTTGGTGGG - Intronic
1089300453 11:117495600-117495622 TCTAGCACACAGCTCTAGGGAGG + Intronic
1090921589 11:131210985-131211007 TCAGGAACATAGAGCTTGGTAGG + Intergenic
1099500288 12:83405524-83405546 TTTAGCACCTAGATATTTGTGGG - Intergenic
1099546774 12:83992135-83992157 TCTAACACATACATTTTGGAGGG + Intergenic
1106752132 13:32785182-32785204 TATATCACATAGGTCTTGTTTGG + Intergenic
1111561772 13:89959750-89959772 TCTACCACATAGATATTAGAAGG + Intergenic
1112597595 13:100822801-100822823 TCTAGAACCTAGATATTGCTTGG - Intergenic
1113424608 13:110197732-110197754 TCTAGCAAATAAATCTTGCTGGG + Intronic
1116712784 14:48390533-48390555 TTTAGCAGATAGTTCTTGGGAGG - Intergenic
1117542486 14:56761906-56761928 TCAAGCACCTACATCTTGCTGGG + Intergenic
1117594660 14:57314056-57314078 TCTGTTACATAGATCTTGATAGG - Intergenic
1118668450 14:68096423-68096445 TTAAGCACATAGCTCTTGGACGG - Intronic
1133164395 16:3936261-3936283 CCCAGCACATATGTCTTGGTGGG + Intergenic
1134183498 16:12065632-12065654 TTTAGCACTTAGCTCTTAGTGGG + Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1141572723 16:84943947-84943969 TCTAACAAATAGAACATGGTGGG + Intergenic
1143600843 17:7944836-7944858 TCTAGAACACAGTTCTTGCTGGG - Intronic
1143933021 17:10450655-10450677 TATATCACATAGTTTTTGGTTGG - Intronic
1146133437 17:30297656-30297678 TCTAGCCCATGGCTCTGGGTTGG - Intergenic
1154271864 18:12927106-12927128 TCTCACACATAGGTCTTGGATGG - Intronic
1155106554 18:22672175-22672197 TGTATAACATAGATTTTGGTAGG + Intergenic
1156297253 18:35803938-35803960 TCTAGTCCCTAGATCTTGGCAGG - Intergenic
1157230799 18:45914088-45914110 TCTTGCACACAGATCTTGCCTGG - Intronic
1158002864 18:52639130-52639152 TGTATCACAGAGATTTTGGTAGG - Intronic
1165426118 19:35746328-35746350 TCTTCCAAATAGATCTCGGTGGG + Intronic
928166411 2:28975775-28975797 TCTAGCACACAGATCTAGGTGGG + Intronic
931250422 2:60526227-60526249 TCTAGCAGAAAGCTATTGGTTGG + Intronic
932357594 2:71079001-71079023 TCTAGCCCCTAAATCTTGCTGGG - Intronic
941299974 2:163788787-163788809 TTTAGCACATAGAAGTTGCTCGG - Intergenic
941343626 2:164339144-164339166 TCTAACACATAGATCATTCTAGG - Intergenic
941607262 2:167614541-167614563 TCTTGAATATTGATCTTGGTTGG - Intergenic
942130133 2:172870325-172870347 TCTATGATATATATCTTGGTAGG + Intronic
942381572 2:175396919-175396941 TCTTGCAGATAGATTTTGGCTGG + Intergenic
942734695 2:179096736-179096758 TCTAGGACTTAGGTCTTGGATGG - Intergenic
943861090 2:192863376-192863398 AACAGCACATAGATGTTGGTAGG - Intergenic
946823716 2:223655554-223655576 TTCAGCATATGGATCTTGGTGGG - Intergenic
1169313928 20:4572228-4572250 TCTAGCTGATAGGTCTTGATTGG - Intergenic
1170878978 20:20277998-20278020 TCTAGCAAATAGAATGTGGTGGG - Intronic
1171109651 20:22468640-22468662 ACTGACAAATAGATCTTGGTAGG - Intergenic
1172602600 20:36194337-36194359 TTTAGCTCCTTGATCTTGGTTGG - Exonic
1174221187 20:48956874-48956896 TCTAAAACAAAGATCCTGGTTGG - Intronic
1178570024 21:33727578-33727600 TTTAGCAAATTGATCTTGTTGGG - Intronic
949102787 3:165972-165994 TCTAGCACATATATGTTGGATGG + Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956475539 3:69616453-69616475 TCTAGTACGTGGCTCTTGGTAGG - Intergenic
956650345 3:71499079-71499101 TCTAGGACACAGAGCTGGGTGGG - Intronic
964193660 3:154036074-154036096 TCTAACACATAAATTTTGGAGGG - Intergenic
970625315 4:17870928-17870950 TCTATCACAAATATCTTGTTTGG - Intronic
971033609 4:22668499-22668521 ATTATTACATAGATCTTGGTGGG + Intergenic
974515542 4:62903708-62903730 ACTGGCACCTTGATCTTGGTTGG - Intergenic
977473668 4:97475156-97475178 TCTAAAACATAGATTTTGCTGGG + Intronic
977868890 4:102065280-102065302 TCTCCCAGATAGATCTTGTTGGG - Intronic
981704231 4:147642138-147642160 TTTAGAACATAGATCTTTTTTGG + Intronic
982016505 4:151159657-151159679 TCTAGCACATAGATCTTGGTTGG - Intronic
983715036 4:170771562-170771584 TATAGCAGATAGATCTTGGCTGG + Intergenic
983814774 4:172109850-172109872 TGTAGCATACAAATCTTGGTGGG + Intronic
987338789 5:16921175-16921197 TCTCCCACATATATCTTGGATGG - Intronic
989315108 5:40069413-40069435 TATAGCACTAAGATCTTGCTTGG - Intergenic
989672922 5:43939895-43939917 TGTATCCCATAGATTTTGGTAGG - Intergenic
993625527 5:90220140-90220162 TTTAGCACATTGTTCTTGGGTGG + Intergenic
994083724 5:95735499-95735521 TCTGTCACATAGACCTTGGTTGG + Intronic
996638797 5:125728536-125728558 TCAATCAGATAGATCTTTGTAGG + Intergenic
998127867 5:139636344-139636366 TCTGGCTCAGAGACCTTGGTGGG - Intergenic
999969307 5:156843218-156843240 TCCAGGAAATAGATCTTGGGTGG + Intergenic
1001197549 5:169686994-169687016 TCTACCACCTAGATCTTCCTGGG + Intronic
1012012212 6:93803580-93803602 TCTAGCAAAAAGATTTTGTTTGG + Intergenic
1014024166 6:116625669-116625691 TCTAGCACATAAAAATTTGTTGG - Intronic
1015586475 6:134781699-134781721 TCTGTCACAGAGATCATGGTTGG + Intergenic
1018253313 6:161894023-161894045 TATAGCACATAGAACTTAGCTGG - Intronic
1021485682 7:21165911-21165933 ACTAACACATAGATGGTGGTTGG + Intergenic
1026358080 7:69577264-69577286 TCTAGAACACATATTTTGGTTGG + Intergenic
1027421005 7:78018516-78018538 TTTAGCTCATAGATCTTAATTGG - Exonic
1027685250 7:81272468-81272490 TCTAGCACATTGATCATGGTTGG - Intergenic
1028995378 7:97094618-97094640 TCTAGCACATTGATGGTGGGAGG - Intergenic
1030378478 7:108782367-108782389 TCTAACACATAAATTTTGGGGGG + Intergenic
1030739791 7:113095111-113095133 TTCAGCACATAGAATTTGGTTGG + Intergenic
1034313214 7:150108514-150108536 TCCAGCACATAAATTTTGGGGGG - Intergenic
1034793647 7:153992153-153992175 TCCAGCACATAAATTTTGGGGGG + Intronic
1038469804 8:27805606-27805628 CCTACCACCCAGATCTTGGTTGG + Intronic
1044104772 8:88190248-88190270 TCTGGCACAGAGATATTAGTGGG + Intronic
1046993681 8:120490044-120490066 TCCAGCACATTTATCTAGGTTGG + Intronic
1047726749 8:127690595-127690617 TGTAGCACCTAGATCAAGGTAGG + Intergenic
1051264058 9:15294378-15294400 GGTAGCACCTAGATGTTGGTAGG - Intronic
1052053056 9:23870737-23870759 TGTAGCACAGAGATTTTGATAGG - Intergenic
1057345207 9:94244353-94244375 TATAGCACACAGGTCTTGGTGGG - Intergenic
1058606205 9:106726240-106726262 TCTAGCACACAGCTCTGGTTTGG + Intergenic
1059034085 9:110734500-110734522 TCTAGGACAAAGATATTGGGAGG - Intronic
1185572036 X:1141992-1142014 TCAAGCATATAGGGCTTGGTTGG + Intergenic
1185572075 X:1142341-1142363 TCAAGCATATAGGGCTTGGTTGG + Intergenic
1194766988 X:97853087-97853109 TCTAGGACAAAGAGCTTGATGGG + Intergenic
1195385913 X:104313455-104313477 GCCAGCACCTTGATCTTGGTTGG + Intergenic
1198814192 X:140569789-140569811 TCTTGAACATATATTTTGGTGGG - Intergenic
1199152601 X:144504982-144505004 TCTCTCACATAGCTGTTGGTAGG - Intergenic