ID: 982019502

View in Genome Browser
Species Human (GRCh38)
Location 4:151189488-151189510
Sequence CTCCCACAATTCCGTGTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 2, 1: 1, 2: 11, 3: 11, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982019496_982019502 6 Left 982019496 4:151189459-151189481 CCCCACCCAAATTTCATCGTGAA 0: 1
1: 390
2: 8608
3: 11663
4: 9464
Right 982019502 4:151189488-151189510 CTCCCACAATTCCGTGTCGTGGG 0: 2
1: 1
2: 11
3: 11
4: 45
982019498_982019502 4 Left 982019498 4:151189461-151189483 CCACCCAAATTTCATCGTGAATT 0: 2
1: 410
2: 8630
3: 11673
4: 9834
Right 982019502 4:151189488-151189510 CTCCCACAATTCCGTGTCGTGGG 0: 2
1: 1
2: 11
3: 11
4: 45
982019500_982019502 0 Left 982019500 4:151189465-151189487 CCAAATTTCATCGTGAATTGTAA 0: 1
1: 125
2: 2935
3: 11003
4: 12949
Right 982019502 4:151189488-151189510 CTCCCACAATTCCGTGTCGTGGG 0: 2
1: 1
2: 11
3: 11
4: 45
982019497_982019502 5 Left 982019497 4:151189460-151189482 CCCACCCAAATTTCATCGTGAAT 0: 1
1: 391
2: 8612
3: 11401
4: 10292
Right 982019502 4:151189488-151189510 CTCCCACAATTCCGTGTCGTGGG 0: 2
1: 1
2: 11
3: 11
4: 45
982019499_982019502 1 Left 982019499 4:151189464-151189486 CCCAAATTTCATCGTGAATTGTA 0: 2
1: 370
2: 7898
3: 10922
4: 9500
Right 982019502 4:151189488-151189510 CTCCCACAATTCCGTGTCGTGGG 0: 2
1: 1
2: 11
3: 11
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982019502 Original CRISPR CTCCCACAATTCCGTGTCGT GGG Intronic
903962850 1:27067731-27067753 CTCCCACAGTTCTGTGAGGTTGG - Intergenic
907280006 1:53341203-53341225 CTCCCACAATCAGGTGTTGTGGG + Intergenic
909668301 1:78160348-78160370 ATCCAACAATTACGTGTCTTGGG - Intergenic
909813286 1:79958889-79958911 CTCCCATAATCCCATGTCATAGG - Intergenic
913439472 1:118882664-118882686 CTCCCACAATTCTGTGAGATAGG - Intergenic
919141965 1:193583613-193583635 CTCCCACAATTCCGTGTCGTGGG - Intergenic
1067528264 10:47051366-47051388 CCCCCACATTGCCTTGTCGTGGG - Intergenic
1078111246 11:8395200-8395222 CTCCCATAATTCCGTGTTGTGGG + Intronic
1078337937 11:10478496-10478518 CTCCCACTTTTCCTTGTCCTTGG + Intronic
1079563018 11:21846425-21846447 CTCCCAGAATTCCATGTTCTGGG - Intergenic
1080182445 11:29441676-29441698 CTCCCATAATTCCGTGTCATGGG + Intergenic
1080342439 11:31281625-31281647 CTCCCATAATTCCGTTTTGTGGG + Intronic
1080723855 11:34875255-34875277 CTCCCATAATTCCGTGTTGTGGG + Intronic
1084883923 11:72191066-72191088 CTCCCAAAATTCAGTGTCTGAGG + Intronic
1090854760 11:130601849-130601871 CTCCCACCATCCTGTGACGTTGG + Intergenic
1094276752 12:28685620-28685642 CTCCCATAATTCCGTGTTCTAGG - Intergenic
1099536664 12:83854547-83854569 CTCCCATAATCCCATGTTGTGGG + Intergenic
1106546502 13:30735322-30735344 CTCCTACATTTCCTTGTCATGGG - Intronic
1108927782 13:55774654-55774676 ATCCCACAAGTCCGTGCTGTTGG + Intergenic
1108927843 13:55775547-55775569 ATCCCACAAGTCCGTGCTGTTGG + Intergenic
1110605719 13:77429837-77429859 CTCCCACAGTTCCGTGTTGTGGG - Intergenic
1114812653 14:25918134-25918156 CTCCCATAATTCTGTATTGTGGG + Intergenic
1114986855 14:28239717-28239739 CTCCCACAATTCCCAGGTGTTGG + Intergenic
1123818989 15:24007555-24007577 CTCCCATAATTCCGTGTCATGGG - Intergenic
1131659650 15:94499704-94499726 CTCCCATAATTCCATGTGGTGGG + Intergenic
1139100127 16:63756074-63756096 CTTCTACAATTCCGTGTCTGAGG - Intergenic
1139276861 16:65735894-65735916 CTCCCACAATTCCATATCCTGGG - Intergenic
1142555684 17:775297-775319 CTCCCACAATCCCATCTGGTAGG - Intronic
1149233973 17:54569685-54569707 CTCCCACAATTTTGTTTTGTGGG - Intergenic
1149303741 17:55328859-55328881 CTCCCACAATCCTGTGTCATGGG - Intergenic
1150856208 17:68755500-68755522 CTCACACAATTCTATGTGGTCGG + Intergenic
1153888537 18:9490732-9490754 CTCCCAGAATTCCATGTTTTGGG + Intronic
1157399721 18:47377395-47377417 TTCCCATAATCCCGTGTCATAGG - Intergenic
1160885875 19:1347630-1347652 CTCCCACGATTCCGTGTTGTGGG - Intergenic
1162547629 19:11339978-11340000 CTCCCACAACTCTGTGAGGTTGG - Intronic
928768083 2:34671522-34671544 CTCCCATAATTCCCTGTCGTGGG - Intergenic
932711726 2:74070443-74070465 CTCCCATAATTCCGTGTTGTGGG - Intronic
935738981 2:106130168-106130190 CTCCCATAGTTCTGTGTCTTTGG - Intronic
936863206 2:117047001-117047023 CTCCCACACTTCCGTTATGTGGG - Intergenic
937753353 2:125505033-125505055 CTCCCATAATTATGTGTTGTGGG - Intergenic
947176191 2:227369805-227369827 CTCTCACAATTCCCTGTGGAAGG - Intronic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1176447037 21:6830047-6830069 CTCCCAGAGTTCCGGGTCGCGGG + Intergenic
1176657593 21:9601834-9601856 CTGCCACAATTCCGTGTTGTGGG - Intergenic
1176825208 21:13695073-13695095 CTCCCAGAGTTCCGGGTCGCGGG + Intergenic
1178025372 21:28460370-28460392 CACCCACAATTCTGTGTCATGGG + Intergenic
1179794012 21:43771901-43771923 CTCCCATAATCCCGTGTCATGGG - Intergenic
955571335 3:60310111-60310133 CTCCCACATTTCTCTGCCGTGGG + Intronic
957632049 3:82728366-82728388 CGCCCATAAGTCCCTGTCGTAGG + Intergenic
957881082 3:86213687-86213709 CTCCCATAATCCTGTGTCATGGG + Intergenic
958428452 3:94007693-94007715 CTCTCATAATTCTGTGTTGTGGG - Intronic
959645459 3:108694660-108694682 CTCCCATTATTCCATGTTGTGGG - Exonic
963898159 3:150707678-150707700 TTCCCATAATCCCGTGTCGTGGG - Intergenic
969229212 4:5818037-5818059 CTCCCATAATTCCGTGATGTGGG + Intronic
982019502 4:151189488-151189510 CTCCCACAATTCCGTGTCGTGGG + Intronic
992554834 5:77892997-77893019 CTCCCAGATTTCCTTGTAGTTGG + Intergenic
1009532763 6:64842386-64842408 CTCCCATAATTCCGTGTTGTGGG + Intronic
1014691531 6:124569478-124569500 CTCCCAGAATTCCCAGTTGTGGG + Intronic
1024627609 7:51221339-51221361 CTCCCACAATGCTGTCTTGTGGG - Intronic
1028252960 7:88557821-88557843 CTCCCAGAATTATGTGTTGTGGG + Intergenic
1033845796 7:145430145-145430167 CTCGCATAATTCCTTGTTGTGGG - Intergenic
1037257250 8:16969348-16969370 CTCCCACAATTCCGTGTTGTGGG + Intergenic
1041953926 8:63536636-63536658 CTCCCATAATTCTGTGTCGCGGG - Intergenic
1045409101 8:101897876-101897898 TTCCCATAATTCCGTGTTGTAGG + Intronic
1046150422 8:110217119-110217141 CTCCCATAATCCCATGTCATGGG - Intergenic
1051083450 9:13319654-13319676 CTCCCATAATCCCATGTTGTGGG - Intergenic
1058122003 9:101148854-101148876 TTCCCACAATTCCGTCTGCTTGG + Intronic
1060240098 9:121896197-121896219 TTCCCAGCATTCCGTGTCTTGGG - Intronic
1203522153 Un_GL000213v1:54484-54506 CTCCCAGAGTTCCGGGTCGCGGG - Intergenic
1203635321 Un_KI270750v1:105408-105430 CTGCCACAATTCCGTGTTGTGGG - Intergenic