ID: 982026507

View in Genome Browser
Species Human (GRCh38)
Location 4:151257668-151257690
Sequence ATGCTTTGGGAGCCTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4186
Summary {0: 1, 1: 2, 2: 31, 3: 353, 4: 3799}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982026498_982026507 14 Left 982026498 4:151257631-151257653 CCGTGGCTGGGTGCGGTGGCTCA 0: 90
1: 814
2: 2748
3: 5660
4: 7677
Right 982026507 4:151257668-151257690 ATGCTTTGGGAGCCTGGGGAGGG 0: 1
1: 2
2: 31
3: 353
4: 3799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982026507 Original CRISPR ATGCTTTGGGAGCCTGGGGA GGG Intronic
Too many off-targets to display for this crispr