ID: 982031768

View in Genome Browser
Species Human (GRCh38)
Location 4:151308413-151308435
Sequence TGGGACCTAGGGCCTGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 509}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982031768_982031779 20 Left 982031768 4:151308413-151308435 CCCCCCACAGGCCCTAGGTCCCA 0: 1
1: 0
2: 1
3: 32
4: 509
Right 982031779 4:151308456-151308478 GCATTTCTAGGTGAGCCATGTGG 0: 1
1: 0
2: 0
3: 19
4: 114
982031768_982031780 21 Left 982031768 4:151308413-151308435 CCCCCCACAGGCCCTAGGTCCCA 0: 1
1: 0
2: 1
3: 32
4: 509
Right 982031780 4:151308457-151308479 CATTTCTAGGTGAGCCATGTGGG 0: 1
1: 0
2: 0
3: 10
4: 136
982031768_982031777 -2 Left 982031768 4:151308413-151308435 CCCCCCACAGGCCCTAGGTCCCA 0: 1
1: 0
2: 1
3: 32
4: 509
Right 982031777 4:151308434-151308456 CATCAGACAAAAGCAATTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 237
982031768_982031778 8 Left 982031768 4:151308413-151308435 CCCCCCACAGGCCCTAGGTCCCA 0: 1
1: 0
2: 1
3: 32
4: 509
Right 982031778 4:151308444-151308466 AAGCAATTGCAGGCATTTCTAGG 0: 1
1: 0
2: 8
3: 21
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982031768 Original CRISPR TGGGACCTAGGGCCTGTGGG GGG (reversed) Intronic