ID: 982033502

View in Genome Browser
Species Human (GRCh38)
Location 4:151324592-151324614
Sequence TTGGGTACACAAAAGCGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982033502_982033506 5 Left 982033502 4:151324592-151324614 CCGTGCCGCTTTTGTGTACCCAA 0: 1
1: 0
2: 0
3: 3
4: 57
Right 982033506 4:151324620-151324642 AGTATCATAAAAGTAATTACAGG 0: 1
1: 0
2: 2
3: 22
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982033502 Original CRISPR TTGGGTACACAAAAGCGGCA CGG (reversed) Intronic
900460391 1:2799886-2799908 TTGGGTGCTCCAAAGGGGCAGGG + Intronic
900711192 1:4115502-4115524 CTGGGAACACACAAGAGGCAAGG - Intergenic
914679928 1:149931892-149931914 GTGGGTAAAGAAAAGAGGCAAGG + Intronic
914929135 1:151914505-151914527 ATGGGTACACCAAAGAGACATGG - Intergenic
921303070 1:213769000-213769022 TAGGGACAACAAAAGCGGCAGGG + Intergenic
1063556088 10:7081137-7081159 CTGGGTAGGCAAAAGCTGCAGGG - Intergenic
1070800938 10:79243923-79243945 GTGGGCACACAAAACCGGCCCGG - Intronic
1071888705 10:89978941-89978963 TGAGGTACCCAAGAGCGGCAAGG + Intergenic
1081124417 11:39305313-39305335 TTGGGTACACAAAAATCCCATGG + Intergenic
1089372540 11:117971591-117971613 TTTGGTATAAAAAAGAGGCAGGG + Intergenic
1090082451 11:123623080-123623102 TTGGGAACACAGAAGCATCAAGG + Intronic
1093475159 12:19546897-19546919 TTGGCTGCACAAAAGCTGAACGG - Intronic
1099114465 12:78607479-78607501 TAAGGTTCACAAAAGAGGCAGGG + Intergenic
1111911947 13:94322758-94322780 TAGGCTCCACAAAAGCAGCAGGG + Intronic
1118475741 14:66115209-66115231 GTGGGTTCACAAAACCAGCACGG - Intergenic
1128831855 15:70776777-70776799 TAGGGGACTCAGAAGCGGCAGGG - Intergenic
1131717703 15:95131343-95131365 CAGGGTACACAAGAGCGGAAGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133312417 16:4858230-4858252 TAAGGTACAGAAAAGGGGCATGG + Intronic
1147968701 17:44207913-44207935 TGGGGGAGACAGAAGCGGCAAGG + Intronic
1149453242 17:56766495-56766517 TTGGGTCCAGAAAACCAGCAGGG + Intergenic
1150286791 17:63959246-63959268 TCTGGTACACAAAAGCCCCAGGG - Exonic
1151838476 17:76600120-76600142 TTGGGTACAGAAGAGAGGCTTGG - Intergenic
1152244546 17:79178245-79178267 TTGGGTTCAGAAAAGCGGAAGGG - Intronic
1157001991 18:43537919-43537941 AAGGGTCCACAAAAGAGGCAGGG + Intergenic
932757272 2:74417488-74417510 TTGGCTACAGGAAAGCGGGAGGG - Exonic
942307122 2:174619639-174619661 TTGGCTACATAAAAGCTCCAGGG + Intronic
942873435 2:180764157-180764179 TTGGTTACACAAAAGAGGGAGGG + Intergenic
945680631 2:212909779-212909801 CTGGGGACACAAGAGCGGAAAGG + Intergenic
1175973214 20:62697583-62697605 TTGGGGACACCAGAGCTGCAGGG + Intergenic
1179818993 21:43925525-43925547 GTGGGTAGACAAAAGGGGGAGGG + Intronic
1183556381 22:38530514-38530536 TTGGCTTCACAAAAGCAACAGGG + Intronic
1184729694 22:46365772-46365794 TTGGGAACACAGAAGGGGTAGGG - Intronic
950549596 3:13658120-13658142 CTGGGTACAAAGAAGCAGCAAGG - Intergenic
953135585 3:40178978-40179000 TAGGGTACACAGAAGACGCAGGG - Intronic
959173744 3:102877278-102877300 TGGGGTACACAAATGGGACAAGG + Intergenic
971171750 4:24240830-24240852 TTGGGTACACCCTAGAGGCAGGG + Intergenic
975967397 4:79990744-79990766 TAGAGTACACCAAAGCAGCATGG + Intronic
976380985 4:84398440-84398462 TTGGATACCCAAAAGAGGAATGG + Intergenic
979338414 4:119490572-119490594 TAGGGTACACTAAATAGGCATGG - Intergenic
982033502 4:151324592-151324614 TTGGGTACACAAAAGCGGCACGG - Intronic
982789776 4:159577378-159577400 TTTTGTACATAAAAGCAGCAGGG + Intergenic
989213113 5:38877266-38877288 TTGGGTACACACATACAGCATGG + Intronic
989353999 5:40520671-40520693 TTGGGTACACAATGGCGGTAAGG - Intergenic
993407654 5:87531545-87531567 GTGGGTACACAAAAGAGAGAAGG - Intergenic
1001771131 5:174296846-174296868 ATGGGTACAGCAAAGCAGCATGG - Intergenic
1006082470 6:31575356-31575378 TTGGGGACACACAAGCATCAAGG - Intergenic
1015081111 6:129226948-129226970 TTGGGTACATGAAAGTGGCGGGG - Intronic
1018230599 6:161671405-161671427 TGGGGTACACATCCGCGGCATGG + Intronic
1022212857 7:28228311-28228333 TTGTATAAACAAAAGGGGCAAGG - Intergenic
1024510012 7:50196537-50196559 TTGGCTACACTACAGCGGCCAGG - Intergenic
1028916748 7:96267845-96267867 TTTGGTACAACAAAGTGGCAGGG + Intronic
1033111551 7:138582879-138582901 TTTTGTACCCAAAAGAGGCAGGG + Intronic
1039493375 8:37964335-37964357 TTAGTTACACAAAAACGCCAGGG + Intronic
1041362157 8:57065811-57065833 TGGGGTACACAAAAGAAGGAGGG - Intergenic
1041945763 8:63440649-63440671 ATTGGAACACAAAAGCAGCATGG + Intergenic
1042877355 8:73451430-73451452 TTGGGGCCAGAAAAGCGGCTGGG + Intronic
1042912361 8:73840671-73840693 TTTGGTATGCAAAAGGGGCAGGG - Intronic
1057441428 9:95086436-95086458 TTGCGTACACAATAGCTGCTAGG - Intronic
1191250909 X:58259780-58259802 GTGGGCACGCCAAAGCGGCAAGG + Intergenic
1193804763 X:85982131-85982153 TTGGGTTAACAAATGTGGCAAGG + Intronic