ID: 982033522

View in Genome Browser
Species Human (GRCh38)
Location 4:151324743-151324765
Sequence CGAGCTCACCAGTTTTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 83}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982033522_982033530 -8 Left 982033522 4:151324743-151324765 CCTACAGAAAACTGGTGAGCTCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 982033530 4:151324758-151324780 TGAGCTCGGCGGCTGGGGGAGGG 0: 1
1: 0
2: 1
3: 28
4: 583
982033522_982033529 -9 Left 982033522 4:151324743-151324765 CCTACAGAAAACTGGTGAGCTCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 982033529 4:151324757-151324779 GTGAGCTCGGCGGCTGGGGGAGG No data
982033522_982033532 -4 Left 982033522 4:151324743-151324765 CCTACAGAAAACTGGTGAGCTCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 982033532 4:151324762-151324784 CTCGGCGGCTGGGGGAGGGAGGG 0: 1
1: 0
2: 2
3: 55
4: 697
982033522_982033536 2 Left 982033522 4:151324743-151324765 CCTACAGAAAACTGGTGAGCTCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 982033536 4:151324768-151324790 GGCTGGGGGAGGGAGGGAGGGGG No data
982033522_982033534 0 Left 982033522 4:151324743-151324765 CCTACAGAAAACTGGTGAGCTCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 982033534 4:151324766-151324788 GCGGCTGGGGGAGGGAGGGAGGG 0: 1
1: 1
2: 47
3: 473
4: 3541
982033522_982033540 25 Left 982033522 4:151324743-151324765 CCTACAGAAAACTGGTGAGCTCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 982033540 4:151324791-151324813 GTCACAGGTCCGAAGTGCAAGGG 0: 1
1: 0
2: 0
3: 8
4: 132
982033522_982033533 -1 Left 982033522 4:151324743-151324765 CCTACAGAAAACTGGTGAGCTCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 982033533 4:151324765-151324787 GGCGGCTGGGGGAGGGAGGGAGG 0: 1
1: 4
2: 45
3: 475
4: 3598
982033522_982033531 -5 Left 982033522 4:151324743-151324765 CCTACAGAAAACTGGTGAGCTCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 982033531 4:151324761-151324783 GCTCGGCGGCTGGGGGAGGGAGG 0: 1
1: 0
2: 1
3: 66
4: 760
982033522_982033538 10 Left 982033522 4:151324743-151324765 CCTACAGAAAACTGGTGAGCTCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 982033538 4:151324776-151324798 GAGGGAGGGAGGGGGGTCACAGG 0: 1
1: 1
2: 6
3: 160
4: 1647
982033522_982033535 1 Left 982033522 4:151324743-151324765 CCTACAGAAAACTGGTGAGCTCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 982033535 4:151324767-151324789 CGGCTGGGGGAGGGAGGGAGGGG No data
982033522_982033539 24 Left 982033522 4:151324743-151324765 CCTACAGAAAACTGGTGAGCTCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 982033539 4:151324790-151324812 GGTCACAGGTCCGAAGTGCAAGG 0: 1
1: 0
2: 0
3: 4
4: 102
982033522_982033537 3 Left 982033522 4:151324743-151324765 CCTACAGAAAACTGGTGAGCTCG 0: 1
1: 0
2: 1
3: 10
4: 83
Right 982033537 4:151324769-151324791 GCTGGGGGAGGGAGGGAGGGGGG 0: 2
1: 18
2: 226
3: 1714
4: 14291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982033522 Original CRISPR CGAGCTCACCAGTTTTCTGT AGG (reversed) Intronic
901812429 1:11775597-11775619 CTAGCTCACCTGCTTTCTGCCGG - Exonic
902610116 1:17592293-17592315 TGACCTCAGCACTTTTCTGTGGG + Intronic
902927297 1:19704591-19704613 TGAGCTCAGCAGCTTTCTCTGGG + Intronic
907544298 1:55246174-55246196 AAAGCTCAAAAGTTTTCTGTGGG - Intergenic
909401343 1:75234681-75234703 CCAGCTCCCCAGTGATCTGTGGG + Intronic
909407583 1:75309345-75309367 TGAGCTCACGAGTTCACTGTTGG + Intronic
915461405 1:156072638-156072660 CAAGCCCTCCAGTTTTGTGTGGG + Exonic
922911180 1:229218550-229218572 AGAGCTCACCCCGTTTCTGTGGG - Intergenic
1064367718 10:14723248-14723270 CGAGCACTCCAGTCTTCAGTAGG + Intronic
1067533368 10:47090776-47090798 CAAGCTAACCAGTTTCCTTTTGG + Intergenic
1067540814 10:47150999-47151021 CCATCTCACCATTTTTTTGTTGG + Intergenic
1070334617 10:75444225-75444247 AGAGGTCACCAGTTTACTGTTGG - Intronic
1073423777 10:103443908-103443930 AGAGTTCACCAGCTTCCTGTGGG - Exonic
1076359364 10:129876158-129876180 CAATCTCAGCAGCTTTCTGTAGG - Intronic
1077546263 11:3171476-3171498 CGAGCACACCTGTTTACAGTTGG - Intergenic
1080028873 11:27639922-27639944 CAGGCTCACCAGTTGTTTGTTGG + Intergenic
1085941626 11:81212537-81212559 CCAGCTCAAGAGTTTTCTATGGG - Intergenic
1088287288 11:108201828-108201850 CAAGCTCCCCAGCTTTCTCTGGG - Intronic
1088758888 11:112910622-112910644 CGATCTCTCCAGCTTTCTGAAGG + Intergenic
1090481572 11:127073563-127073585 CTATCTCACAAGGTTTCTGTAGG + Intergenic
1091043561 11:132305064-132305086 AGAACTCATCAGTTTTCTGTGGG - Intronic
1094492167 12:30967563-30967585 AGAGATCACCAGTTCTGTGTGGG - Intronic
1098324206 12:69284194-69284216 CGAGTTGACCATTTTTCTATTGG - Intergenic
1102569872 12:113820901-113820923 CCAGCTCACCAGCTTTCTTTTGG + Intronic
1102888368 12:116538644-116538666 AGAGCACCCCAGTTTTCTTTGGG - Intergenic
1110993892 13:82079781-82079803 GGAGTTCAGCAGTCTTCTGTAGG - Intergenic
1111783763 13:92761849-92761871 CTAGCTCACAAGATTTCTGTGGG - Intronic
1112795822 13:103055576-103055598 CAAGCTCACCTTTTTGCTGTTGG - Intronic
1112916085 13:104552149-104552171 CAAGTTCACCAGTTTTCTGTGGG + Intergenic
1114130700 14:19788477-19788499 CGAGCTCCACAATTTTATGTTGG + Intronic
1118455295 14:65940481-65940503 GGATCTGACCACTTTTCTGTAGG - Intergenic
1118502278 14:66372897-66372919 CTAGTTCACCAGTTTGCAGTTGG + Intergenic
1123573757 15:21644113-21644135 CGAGCTCCACAATTTTATGTTGG + Intergenic
1123610375 15:22086698-22086720 CGAGCTCCACAATTTTATGTTGG + Intergenic
1130030624 15:80310301-80310323 CAAGCACACCAATTTTCAGTTGG - Intergenic
1202982622 15_KI270727v1_random:378452-378474 CGAGCTCCACAATTTTATGTTGG + Intergenic
1134846423 16:17444640-17444662 CCAGCTCACCATTTTATTGTAGG + Intronic
1145103905 17:20098946-20098968 TGAGCACACCTGTTTTCTGGCGG + Intronic
1150607259 17:66704599-66704621 CAAGATCACCAATTTTCTTTTGG - Intronic
1156694513 18:39750591-39750613 AGATTTCACCAGTTTTCTGGTGG - Intergenic
1157825787 18:50810994-50811016 CAAGCTCACCAGTGTGCTTTGGG - Intronic
1159389506 18:67771242-67771264 TGAGCTAGCCAGTTTTGTGTGGG - Intergenic
1159996385 18:74969586-74969608 CCAGGTCACCAGGTGTCTGTTGG + Intronic
925168042 2:1731124-1731146 CGCTCTCAACAGTGTTCTGTTGG - Intronic
925542837 2:4985087-4985109 GGAGCTCAACAGCTTTCTCTTGG - Intergenic
927173689 2:20390857-20390879 CCAGCTCTGAAGTTTTCTGTGGG + Intergenic
927858173 2:26540378-26540400 CGGGCTCCCAGGTTTTCTGTAGG - Intronic
929476741 2:42258218-42258240 AGAGGTCACTAGTTTTATGTGGG - Intronic
937445854 2:121957236-121957258 CGAGTTTTCTAGTTTTCTGTAGG - Intergenic
942115266 2:172722402-172722424 CAAGCTTGCCAGTTATCTGTAGG + Intergenic
942587757 2:177502789-177502811 GTATCCCACCAGTTTTCTGTAGG + Intronic
944674059 2:202020384-202020406 CCCACTCACCAGCTTTCTGTGGG + Intergenic
946326862 2:218989130-218989152 ACAGCTCACCAGTTTTCTGAAGG + Intergenic
1178746727 21:35258803-35258825 CCAGCTCAACTGTTTTCTTTGGG - Intronic
1179219392 21:39393008-39393030 CGTGCTCATCTGTTGTCTGTGGG + Intronic
950423589 3:12912833-12912855 AGAGCTCCCCAGTTTCCTTTTGG + Intronic
951578338 3:24136191-24136213 CAAGCTCACAAGTTTTCTGATGG + Intronic
951946628 3:28144462-28144484 AGAAATCACCAGTTTTCTGTTGG + Intergenic
953529367 3:43726285-43726307 CCAGCTTACCATATTTCTGTCGG + Intronic
957985292 3:87567144-87567166 CTAACTCATCAATTTTCTGTGGG - Intergenic
960900322 3:122548014-122548036 CCATCTCACCAGTTAGCTGTGGG + Intronic
961026869 3:123565996-123566018 CCAGATCACTAGTTTTCTCTGGG + Intronic
964075712 3:152688966-152688988 TGAGTGCACCAGTTTTGTGTTGG - Intergenic
966474792 3:180331703-180331725 CTAGCTCTCCTGTTCTCTGTTGG + Intergenic
967458581 3:189719153-189719175 CGAGAACACCGTTTTTCTGTGGG - Intronic
971779323 4:31011042-31011064 CAAGCCCATCATTTTTCTGTGGG + Intronic
974565551 4:63575447-63575469 CAAGCTCTCCAGCTTTCTCTGGG + Intergenic
979903675 4:126256073-126256095 TGAGCTCACTTGGTTTCTGTAGG + Intergenic
982033522 4:151324743-151324765 CGAGCTCACCAGTTTTCTGTAGG - Intronic
987118017 5:14741893-14741915 CGTGCTCACCAGTTTGTTGCTGG + Exonic
988603920 5:32664374-32664396 CAAGCTCCCCAGTTTTCCCTGGG + Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999648048 5:153738535-153738557 AGAGCTCACTAGTTTTTTGAGGG - Intronic
1001192964 5:169647592-169647614 CAAGCTCACCAGTTCTCCCTGGG + Intronic
1002654416 5:180732767-180732789 GGGGCTCACCATTTTTCTGTGGG - Intergenic
1007338639 6:41173825-41173847 CGAGCTGCCCAGTGTGCTGTGGG - Intergenic
1007989377 6:46239409-46239431 GGAGTTCACCACTTTTCTCTGGG - Intronic
1013807245 6:114009982-114010004 AGAGCTCACCAGTTTTACTTTGG + Intronic
1019784395 7:2965847-2965869 AGAGATCACCAGTTTTGTTTGGG + Intronic
1025015559 7:55436277-55436299 TGAGCTCACCTGTTCCCTGTGGG + Intronic
1031388607 7:121184549-121184571 CTCACTCACTAGTTTTCTGTAGG - Intronic
1034914664 7:155026922-155026944 CGGGCTCCCCAGTTTCCTCTGGG - Intergenic
1036935538 8:12998697-12998719 AGAGTTCACTAGATTTCTGTGGG + Intronic
1037122251 8:15302768-15302790 CGGGCACTCCGGTTTTCTGTTGG + Intergenic
1038753123 8:30315364-30315386 CGAGCTCTCCAGTTACGTGTGGG - Intergenic
1039004266 8:33016392-33016414 TGATCTCACCATGTTTCTGTCGG + Intergenic
1041148459 8:54905545-54905567 AGAGCTGACCAGTCTTCAGTGGG + Intergenic
1041616715 8:59915874-59915896 CAAGCTCATCAGTGCTCTGTGGG + Intergenic
1044821862 8:96160638-96160660 CTTCCTCATCAGTTTTCTGTGGG - Exonic
1049215096 8:141404145-141404167 CGAGCTCCCCAGGTCTGTGTGGG - Intronic
1055691800 9:78840018-78840040 CCAGGTCACAAGTTTTCTGTCGG + Intergenic
1059501802 9:114760780-114760802 GGATCACACCAGCTTTCTGTTGG + Intergenic
1188869721 X:35359207-35359229 CCATCTCACCACTTTTCTGTAGG + Intergenic
1194123708 X:89989633-89989655 CAAGCTCCCCAGCTTTCTCTGGG + Intergenic
1200476593 Y:3647254-3647276 CAAGCTCCCCAGCTTTCTCTGGG + Intergenic