ID: 982036464 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:151350657-151350679 |
| Sequence | GTGGGAGAACTGATTGAGGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 982036457_982036464 | 7 | Left | 982036457 | 4:151350627-151350649 | CCTGCAGTCCAAGCTACTTGGGA | 0: 11 1: 1880 2: 50132 3: 167182 4: 228425 |
||
| Right | 982036464 | 4:151350657-151350679 | GTGGGAGAACTGATTGAGGCAGG | No data | ||||
| 982036459_982036464 | -1 | Left | 982036459 | 4:151350635-151350657 | CCAAGCTACTTGGGAGGCTGAGG | 0: 92836 1: 203589 2: 246027 3: 262461 4: 302975 |
||
| Right | 982036464 | 4:151350657-151350679 | GTGGGAGAACTGATTGAGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 982036464 | Original CRISPR | GTGGGAGAACTGATTGAGGC AGG | Intergenic | ||
| No off target data available for this crispr | |||||