ID: 982036464

View in Genome Browser
Species Human (GRCh38)
Location 4:151350657-151350679
Sequence GTGGGAGAACTGATTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982036457_982036464 7 Left 982036457 4:151350627-151350649 CCTGCAGTCCAAGCTACTTGGGA 0: 11
1: 1880
2: 50132
3: 167182
4: 228425
Right 982036464 4:151350657-151350679 GTGGGAGAACTGATTGAGGCAGG No data
982036459_982036464 -1 Left 982036459 4:151350635-151350657 CCAAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 982036464 4:151350657-151350679 GTGGGAGAACTGATTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982036464 Original CRISPR GTGGGAGAACTGATTGAGGC AGG Intergenic
No off target data available for this crispr