ID: 982036657

View in Genome Browser
Species Human (GRCh38)
Location 4:151352729-151352751
Sequence ATGGCAGGCAGTCCTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982036657_982036665 23 Left 982036657 4:151352729-151352751 CCACCACCAGGACTGCCTGCCAT No data
Right 982036665 4:151352775-151352797 GCAACACCTTCTGCATGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982036657 Original CRISPR ATGGCAGGCAGTCCTGGTGG TGG (reversed) Intergenic