ID: 982036665

View in Genome Browser
Species Human (GRCh38)
Location 4:151352775-151352797
Sequence GCAACACCTTCTGCATGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982036658_982036665 20 Left 982036658 4:151352732-151352754 CCACCAGGACTGCCTGCCATCCT No data
Right 982036665 4:151352775-151352797 GCAACACCTTCTGCATGATCTGG No data
982036657_982036665 23 Left 982036657 4:151352729-151352751 CCACCACCAGGACTGCCTGCCAT No data
Right 982036665 4:151352775-151352797 GCAACACCTTCTGCATGATCTGG No data
982036662_982036665 0 Left 982036662 4:151352752-151352774 CCTCTGCTGTAAGCCCACTCTTA No data
Right 982036665 4:151352775-151352797 GCAACACCTTCTGCATGATCTGG No data
982036661_982036665 4 Left 982036661 4:151352748-151352770 CCATCCTCTGCTGTAAGCCCACT No data
Right 982036665 4:151352775-151352797 GCAACACCTTCTGCATGATCTGG No data
982036659_982036665 17 Left 982036659 4:151352735-151352757 CCAGGACTGCCTGCCATCCTCTG No data
Right 982036665 4:151352775-151352797 GCAACACCTTCTGCATGATCTGG No data
982036660_982036665 8 Left 982036660 4:151352744-151352766 CCTGCCATCCTCTGCTGTAAGCC No data
Right 982036665 4:151352775-151352797 GCAACACCTTCTGCATGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982036665 Original CRISPR GCAACACCTTCTGCATGATC TGG Intergenic