ID: 982038866

View in Genome Browser
Species Human (GRCh38)
Location 4:151375082-151375104
Sequence ATTCTAGTCTGGGGCAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982038866_982038875 23 Left 982038866 4:151375082-151375104 CCTTTCCTGCCCCAGACTAGAAT No data
Right 982038875 4:151375128-151375150 AAGTTTCTTTCAGTGAAGGATGG No data
982038866_982038873 19 Left 982038866 4:151375082-151375104 CCTTTCCTGCCCCAGACTAGAAT No data
Right 982038873 4:151375124-151375146 TCCTAAGTTTCTTTCAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982038866 Original CRISPR ATTCTAGTCTGGGGCAGGAA AGG (reversed) Intergenic
No off target data available for this crispr