ID: 982039798

View in Genome Browser
Species Human (GRCh38)
Location 4:151385475-151385497
Sequence ACCAAAACGAGATTGCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982039798_982039802 22 Left 982039798 4:151385475-151385497 CCAGTCTGCAATCTCGTTTTGGT No data
Right 982039802 4:151385520-151385542 GCTTCACAAAGATAGGATGTTGG No data
982039798_982039799 15 Left 982039798 4:151385475-151385497 CCAGTCTGCAATCTCGTTTTGGT No data
Right 982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG No data
982039798_982039803 23 Left 982039798 4:151385475-151385497 CCAGTCTGCAATCTCGTTTTGGT No data
Right 982039803 4:151385521-151385543 CTTCACAAAGATAGGATGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982039798 Original CRISPR ACCAAAACGAGATTGCAGAC TGG (reversed) Intergenic