ID: 982039959

View in Genome Browser
Species Human (GRCh38)
Location 4:151387556-151387578
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 5, 1: 2, 2: 1, 3: 18, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982039959_982039963 28 Left 982039959 4:151387556-151387578 CCAATGTTAATCTGTATTTGCAG 0: 5
1: 2
2: 1
3: 18
4: 200
Right 982039963 4:151387607-151387629 CAGCTCCACCTCAGATCATCAGG 0: 27
1: 94
2: 828
3: 1133
4: 925

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982039959 Original CRISPR CTGCAAATACAGATTAACAT TGG (reversed) Intergenic
901392928 1:8959017-8959039 CTTCAAATACAGACACACATGGG - Intronic
902976119 1:20089858-20089880 CTACAAATACAGATTCGCGTGGG + Exonic
904130358 1:28271273-28271295 CTGCAAATGCATATAACCATGGG - Intronic
905406265 1:37734631-37734653 CTGCAACCACAGATTGACAATGG + Intronic
908242894 1:62202842-62202864 CTACAAATACAGATTTAGCTGGG - Intronic
908822472 1:68102604-68102626 CAGCAAATACAGATGAATATAGG - Intronic
910537112 1:88310885-88310907 ATCCAAATAGAGATTAAGATTGG - Intergenic
911512041 1:98818924-98818946 CCACAAATTCAGATTAACGTAGG - Intergenic
912271974 1:108220759-108220781 GTACAAACACAGAATAACATAGG - Intergenic
914776908 1:150745494-150745516 CTACAAATAGAAATTAAAATTGG + Intronic
914985573 1:152454288-152454310 CTACAAATACAGCTAAACAGAGG - Intergenic
917605171 1:176620688-176620710 CTGGTGAGACAGATTAACATAGG - Intronic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
920042219 1:203107851-203107873 TTGAAACTACAGATTAATATAGG + Intronic
920771375 1:208889456-208889478 CTACAAAGACAAATTAACAGGGG - Intergenic
923847828 1:237756556-237756578 CTGAAAAAAAAAATTAACATTGG - Intronic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1064435659 10:15308973-15308995 ATGGAAATACTGATTAAAATAGG - Intronic
1068224493 10:54089584-54089606 CTTCAATTTCAGATTAACATAGG - Intronic
1068690531 10:59909140-59909162 CTGCAAAAACACATGAACAAAGG + Intergenic
1069887419 10:71632762-71632784 ATTCAAAGACAGATTAACAGAGG - Intronic
1070652759 10:78249817-78249839 CTGCATATGCAGATTAAATTTGG + Intergenic
1071574113 10:86713543-86713565 CTGCTAAAAAAGATTAAGATTGG - Intronic
1074606385 10:114972767-114972789 CTGCAAATATGGAAAAACATGGG + Intronic
1075350822 10:121723617-121723639 CTGCAAATGCAGATGACCAGGGG + Intergenic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1077958790 11:7050608-7050630 CTACAAATACAGATCTACTTTGG - Intronic
1080567384 11:33524143-33524165 CTAAACAGACAGATTAACATAGG - Intergenic
1081188463 11:40074441-40074463 TTGCAAATAAAGAATAAGATCGG + Intergenic
1084368834 11:68724196-68724218 ATGCAAAGGCAGATTAACATTGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084994254 11:72959990-72960012 CTTCAAACACATATTAATATAGG + Intronic
1085061670 11:73453056-73453078 CTTCAAATACATTTTAACCTTGG + Intronic
1086512244 11:87571422-87571444 CTGTAACTACAGCTCAACATGGG - Intergenic
1087957915 11:104312652-104312674 TTGCCAAAACAAATTAACATTGG - Intergenic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1091963302 12:4717862-4717884 CTGCTAAAACAGATTTACATAGG - Intronic
1092747814 12:11689952-11689974 GCGCAAATACAGATTCACAAGGG + Intronic
1094793230 12:33939055-33939077 CTAGATATCCAGATTAACATTGG - Intergenic
1096757859 12:53815114-53815136 CTACAAAAACAACTTAACATGGG - Intergenic
1097842117 12:64331862-64331884 CTGGAAAGACAGAATAACAGCGG - Intronic
1100357476 12:93844910-93844932 CTCCTAATACAGATCAATATGGG + Intronic
1102588360 12:113939363-113939385 ATGCTAATCCAAATTAACATGGG + Intronic
1104606048 12:130188444-130188466 ATGCAAATACATATTACCTTAGG - Intergenic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1105467478 13:20659502-20659524 CTGCAAATAAAGATTGGCTTAGG - Intronic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107680560 13:42844422-42844444 CAGCAAATGCAGATTATGATAGG - Intergenic
1110370675 13:74736902-74736924 ATGCACATACAGATTAAGAATGG - Intergenic
1110612298 13:77502478-77502500 CTGCAGCTACAGATTAAATTTGG + Intergenic
1111217822 13:85167168-85167190 TTCCAAATAAAGATTAACCTTGG - Intergenic
1111605990 13:90539639-90539661 CTACAAAAACACAATAACATAGG + Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1113430148 13:110243012-110243034 CTTCAAATAGAAATTAACAAAGG - Intronic
1114879115 14:26761784-26761806 CTGCAAATACAGACTAAGCTTGG - Intergenic
1116172409 14:41420337-41420359 CTGCAAATACAGATATAATTGGG - Intergenic
1116392122 14:44405438-44405460 CTGCACATAGAGATAAACAAGGG + Intergenic
1116992479 14:51291014-51291036 CTGCAAATACAGATTAACATTGG - Intergenic
1117598803 14:57352431-57352453 ATTCAAAAACAGATTAACAGAGG - Intergenic
1117834516 14:59788656-59788678 ATGCAAATTCATATAAACATTGG - Intronic
1118206208 14:63726348-63726370 GTTCAAAGACAGATAAACATTGG + Intronic
1118222396 14:63867335-63867357 CTGAGAATAGAAATTAACATAGG - Intronic
1120352733 14:83383646-83383668 CTGCATAAACAGATTAACAGTGG - Intergenic
1120783997 14:88513750-88513772 CTGCAAATATATCTTAGCATGGG - Intronic
1120833892 14:89023167-89023189 CTGGGAATACAAATGAACATTGG + Intergenic
1202847796 14_GL000009v2_random:197156-197178 CTGAAAATAAAGATTAACCAGGG + Intergenic
1202917270 14_GL000194v1_random:187696-187718 CTGAAAATAAAGATTAACCAGGG + Intergenic
1123962090 15:25414080-25414102 CTGCAACTACATATTACCAACGG + Intronic
1125442850 15:39722048-39722070 CTGCAAATACAGTTGAACTTGGG - Intronic
1126152349 15:45534649-45534671 CTGCAAAAACAGCTTAGGATAGG - Intergenic
1126718028 15:51542969-51542991 ATGAAAATACAGAATAACAAGGG + Intronic
1127061142 15:55186817-55186839 CTGGAAATACATATTAAACTAGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1130842268 15:87711943-87711965 ATGCAAATATATATTATCATAGG + Intergenic
1133828216 16:9297959-9297981 CTGCAACTACAGAATCACCTGGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141356181 16:83349037-83349059 CTGCACATACAGATAAATATGGG - Intronic
1142826909 17:2518861-2518883 CTGAAAAACAAGATTAACATAGG - Intergenic
1146429590 17:32778813-32778835 CTACAAATAAAGATTTACTTAGG + Intronic
1147611584 17:41804806-41804828 CTACAAATACAAAATAAAATTGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1152304227 17:79511869-79511891 GTGCAGATACATATTACCATCGG + Intronic
1153120002 18:1710892-1710914 TTACAAATACAGCTTAACTTTGG - Intergenic
1153817153 18:8800450-8800472 CTGCATATACCGATCAACCTTGG + Intronic
1155228496 18:23751416-23751438 CTCCTATTACAGTTTAACATGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155853331 18:30799981-30800003 CTGAAAATACAAATTACCTTTGG - Intergenic
1157057167 18:44244071-44244093 CTGCATGTACAGAATAAGATTGG - Intergenic
1158099617 18:53815732-53815754 CTGTAAATACAGATTTAAAATGG - Intergenic
1159687430 18:71440236-71440258 TTGAAAATAAAGATTAAAATTGG + Intergenic
1164943842 19:32273349-32273371 CTGGAGATACAGATTAACGTTGG - Intergenic
1166576250 19:43841000-43841022 CTGGAAAGACAGATTGTCATTGG - Intronic
927314422 2:21665425-21665447 CAGGAAATGCAGATTTACATGGG - Intergenic
928776700 2:34773229-34773251 ATGCAAACACAGACTAAAATAGG + Intergenic
929955252 2:46453194-46453216 CTGTAAATACTTATAAACATTGG - Intronic
930335664 2:50042177-50042199 CTGCAAATATTGATTAATCTAGG + Intronic
930485826 2:52009619-52009641 ATGCAAAAATAGACTAACATAGG - Intergenic
931413218 2:62055014-62055036 CTACAAATACAGATTAACATTGG + Intronic
931426531 2:62176958-62176980 CAGCAAATACAGCTTCACAGGGG - Intergenic
931617771 2:64177977-64177999 CTGCAAATACACTTGAAAATGGG + Intergenic
932389775 2:71376735-71376757 GTACAAATCCATATTAACATAGG - Intronic
933331875 2:80902670-80902692 CTGCAAAATAAGATTAGCATGGG - Intergenic
942332999 2:174848512-174848534 CTTTAAATACAGTGTAACATTGG - Intronic
943404200 2:187459639-187459661 GTGCAAATACAGATTAAATATGG + Intergenic
945375182 2:209071392-209071414 CTGCAAATATAGGGTAACAGAGG + Intergenic
945662812 2:212707249-212707271 CTGCAGATATAGATTATGATAGG - Intergenic
946885548 2:224219076-224219098 CTGCAACTCAAGATTAACACTGG + Intergenic
946949097 2:224852840-224852862 GTGCAAATACAAATTACTATGGG - Intronic
947363976 2:229375095-229375117 CTGCAAGTACAGAATATTATAGG - Intronic
947555550 2:231089894-231089916 CTGCCAAAGGAGATTAACATTGG - Intronic
948303301 2:236925458-236925480 CTGAAAATAGAGACTAAAATTGG + Intergenic
1169830395 20:9818849-9818871 CTGCAAATATAAAGAAACATGGG + Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179559052 21:42201201-42201223 CTGCAAATACAGATTAACATTGG - Intronic
1181329115 22:22075330-22075352 CTGCAGACACAGATGCACATGGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182589283 22:31366407-31366429 CTGGAAATAAAGAAAAACATGGG - Intergenic
1184873537 22:47257819-47257841 CTGCAAAATCACATTAAAATGGG - Intergenic
951280435 3:20742306-20742328 CTACAAATAAATAATAACATAGG + Intergenic
957443038 3:80277372-80277394 TTGCAAATCCAGAATGACATTGG - Intergenic
959930115 3:111971391-111971413 TTGCAAAGACACATTTACATGGG - Intronic
960756103 3:121014735-121014757 CTGCAAATACAGATAAGTACTGG - Intronic
961493541 3:127274267-127274289 GTGCAGATGCAGTTTAACATAGG - Intergenic
962366766 3:134791962-134791984 CTGCTAATACAGATATACCTGGG + Intronic
963822120 3:149909044-149909066 CCTCAAATACAGATTAATCTGGG + Intronic
964947390 3:162242970-162242992 CAGCAAATAAAAATTTACATGGG + Intergenic
966505950 3:180701921-180701943 CAGAAAATACAGCTCAACATTGG - Intronic
967432598 3:189404019-189404041 TGGCAAATAAAAATTAACATAGG - Intergenic
970301791 4:14689067-14689089 CTGCAGATACAGATGTACATAGG - Intergenic
971367692 4:25990738-25990760 ATGCACATACACAGTAACATGGG - Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
971863386 4:32138067-32138089 CTGCAAATACAGATTAGCATTGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974715451 4:65664433-65664455 TTGTAAACACAGATTAAAATGGG - Intronic
975419410 4:74145177-74145199 CTGCAAATACAGAATGATTTGGG - Intronic
975749068 4:77504231-77504253 CTGCTATTACAGTTTTACATAGG - Intergenic
976568961 4:86586453-86586475 CTGCAAATTCAAATTAACGAAGG - Intronic
976756543 4:88504378-88504400 TTGGAAATACAGATTATGATTGG + Exonic
976986712 4:91309794-91309816 TTCCAAATCCAGATTCACATTGG - Intronic
977115050 4:93013690-93013712 GTGCAAATACAGATTTACATAGG - Intronic
977628518 4:99215857-99215879 TTACAAGTACAGATTAAAATAGG + Intronic
978316127 4:107439479-107439501 CTGCAAATACAGATTAACATTGG - Intergenic
978767267 4:112416974-112416996 CAGAAAAGACAGATTAATATAGG + Intronic
979623458 4:122821330-122821352 CTGCAAATACAGATTAACATTGG - Intergenic
979829074 4:125278199-125278221 CTGCAAATAGAAGTTAACATTGG + Intergenic
982039959 4:151387556-151387578 CTGCAAATACAGATTAACATTGG - Intergenic
982769575 4:159384064-159384086 CTACAAATATTGATTAAAATGGG + Intergenic
984203332 4:176754942-176754964 CTGAAAATACAGATTGTCACAGG + Intronic
984877326 4:184380858-184380880 TTGCATAAACAGATTAACGTAGG - Intergenic
989153706 5:38324432-38324454 CTGTAAATACAGCTTCAGATGGG + Intronic
989755884 5:44953472-44953494 CTGAAAATCCAGTTTAACAGAGG - Intergenic
991588932 5:68228469-68228491 CTGCAAAGAAAAATTAACTTTGG - Intronic
993162986 5:84313783-84313805 CTGCAAATTCAGAATTACCTGGG - Intronic
993308566 5:86299251-86299273 GTACAAACACAGAATAACATAGG + Intergenic
994057503 5:95434837-95434859 CTGCAATTACAAATTTACTTAGG - Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995076284 5:107988298-107988320 CTGCAGAAACAGATTAATCTGGG + Intronic
995248325 5:109960964-109960986 CAGATAATACAGATTAATATAGG + Intergenic
996108003 5:119529411-119529433 CTGCTAATATAGAATAAAATTGG - Intronic
1000721809 5:164717601-164717623 CTACAAATACAGATAACAATAGG - Intergenic
1000923472 5:167165831-167165853 CTATAAATACTGATTAACAGAGG + Intergenic
1001847155 5:174932468-174932490 CAGCAAAAACAGACTAAGATGGG - Intergenic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1003674305 6:8188888-8188910 CTGCTAAAACAGAATATCATAGG + Intergenic
1003730350 6:8815050-8815072 CTGTATATACACATTAACAAAGG - Intergenic
1003784394 6:9467999-9468021 CTGCAAATTCAAGTTAACAGTGG - Intergenic
1004972690 6:20929319-20929341 CTGGTAATAAAGATTAACCTTGG + Intronic
1006699529 6:35960720-35960742 CTGCAGATACACATTTACAAAGG - Intronic
1009985817 6:70779856-70779878 CTACAAACACAGATCAACATTGG + Intronic
1010441178 6:75896405-75896427 CTACAAATACAAATTGATATAGG + Intronic
1010749693 6:79604155-79604177 CTGGAAATACAGACTTAGATTGG - Intergenic
1011199808 6:84823398-84823420 TTGCCAAAAGAGATTAACATTGG + Intergenic
1012105452 6:95151810-95151832 CAGAAAAAATAGATTAACATAGG - Intergenic
1012120300 6:95357507-95357529 CTTCACAGACAAATTAACATAGG - Intergenic
1014852907 6:126363022-126363044 CTTCAAATTGAGACTAACATAGG - Intergenic
1016771459 6:147856912-147856934 CTGCTAATTCACATTAACACAGG - Intergenic
1016928006 6:149372567-149372589 TTGTAAAGCCAGATTAACATAGG - Intronic
1016959683 6:149660794-149660816 CTGCATATACAGATTGTTATTGG - Exonic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1020571646 7:9870997-9871019 CTTCAAATATAGATAAACAAGGG - Intergenic
1023114952 7:36853672-36853694 GTGCAATTACAGATTGACCTGGG - Intergenic
1023673491 7:42604825-42604847 CTTACAATACAGATTAAAATAGG + Intergenic
1023974023 7:45014437-45014459 CTGCAATTAAAAATTAAAATAGG - Intronic
1024020821 7:45366847-45366869 CTGCAAATTCAGAGCAGCATAGG - Intergenic
1024467210 7:49723862-49723884 CTGGAATTACAGATCAACAAGGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1028057534 7:86265472-86265494 TTTAAAATACAGATTCACATAGG + Intergenic
1028545596 7:91996007-91996029 CTGCTAATTCAGTTTAACATAGG - Intronic
1032416832 7:131742067-131742089 CTGAAAATCCAGATAAAGATGGG + Intergenic
1032571151 7:132999157-132999179 CTGGAAATGCAGATAAATATTGG - Intronic
1032766393 7:134998111-134998133 CTGCAGATACAGTATAACATTGG - Intronic
1033058003 7:138077901-138077923 CTGAAAATGCAGATTAAGACAGG + Intronic
1033111812 7:138586257-138586279 TTATAAATACAGATTAACTTCGG - Exonic
1033939119 7:146629825-146629847 CTGCAAATAATAGTTAACATAGG + Intronic
1039241365 8:35560483-35560505 ATACAAATACACATTTACATAGG - Intronic
1041188111 8:55323643-55323665 CTGCACATACACATTTACAGAGG - Intronic
1041497115 8:58497726-58497748 CTGCAAATAAATATTAGCTTTGG - Intronic
1045110475 8:98935380-98935402 CAGAAAATCCAAATTAACATGGG - Intronic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1051668438 9:19486972-19486994 GTGCAAATAGAGATAAGCATAGG + Intergenic
1051871541 9:21743450-21743472 TTGGAAATAGAGATAAACATTGG - Intergenic
1053470221 9:38340946-38340968 ATGCAAAAACAGACTAACACAGG - Intergenic
1054711319 9:68513902-68513924 CTGCAAATTCTGAAAAACATGGG - Intronic
1055225889 9:73994777-73994799 CTGCAAATAAAAATCAAGATTGG - Intergenic
1056641379 9:88374074-88374096 ATGCAAATCCAGATTACCACAGG + Intergenic
1057762702 9:97889578-97889600 CTGCAATAACAGAATACCATAGG + Intergenic
1058247524 9:102646777-102646799 TTGCCAAAAGAGATTAACATTGG + Intergenic
1059929683 9:119248711-119248733 CTGAAAATACGGCTTAACCTTGG - Intronic
1186053703 X:5626914-5626936 CTGCAAATCCTAATTAATATAGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186514638 X:10157910-10157932 TGGCAAATACAAATTAATATTGG + Intronic
1186620366 X:11234438-11234460 CTGGAAATACAAACAAACATTGG - Intronic
1188202716 X:27310888-27310910 CAGAAAATACAGTTTAAAATGGG - Intergenic
1188256830 X:27972316-27972338 CTGAACAAACTGATTAACATTGG + Intergenic
1188923527 X:36009539-36009561 CTGCAGAAATAGATTATCATGGG + Intergenic
1189821825 X:44875881-44875903 CTGCGAATAGTGCTTAACATTGG + Intronic
1190181854 X:48198967-48198989 CTGAAAATACAGAACAAAATGGG + Intronic
1190194897 X:48308454-48308476 CTGAAAATACAGAACAAAATGGG + Intergenic
1190651977 X:52576636-52576658 CTGCGCATACTGCTTAACATTGG + Intergenic
1192710529 X:73579366-73579388 CTGCAACTACAAACTAACATTGG - Intronic
1196093498 X:111772879-111772901 CTGAAAATACAAATGACCATTGG - Intergenic
1196251964 X:113471429-113471451 CTGAAAATAAAGATTCAAATGGG + Intergenic
1196345241 X:114648193-114648215 CTGAAAATACAGAGTCACAGAGG - Intronic
1198005264 X:132487641-132487663 CTTCAAATATAGACTAAAATGGG - Intronic