ID: 982041349

View in Genome Browser
Species Human (GRCh38)
Location 4:151399860-151399882
Sequence CTACTTTCCTTTAAAAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982041347_982041349 10 Left 982041347 4:151399827-151399849 CCAGACAAGTGCCGGCTCTGGCG No data
Right 982041349 4:151399860-151399882 CTACTTTCCTTTAAAAAAAATGG No data
982041348_982041349 -1 Left 982041348 4:151399838-151399860 CCGGCTCTGGCGCTCTTTTATTC No data
Right 982041349 4:151399860-151399882 CTACTTTCCTTTAAAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982041349 Original CRISPR CTACTTTCCTTTAAAAAAAA TGG Intergenic
No off target data available for this crispr