ID: 982046671

View in Genome Browser
Species Human (GRCh38)
Location 4:151454336-151454358
Sequence GAACAGTCTTTGGCCCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982046671_982046675 -6 Left 982046671 4:151454336-151454358 CCTGTTTGGGCCAAAGACTGTTC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 982046675 4:151454353-151454375 CTGTTCCTATAGGTAACTTTGGG No data
982046671_982046674 -7 Left 982046671 4:151454336-151454358 CCTGTTTGGGCCAAAGACTGTTC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 982046674 4:151454352-151454374 ACTGTTCCTATAGGTAACTTTGG 0: 1
1: 0
2: 1
3: 4
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982046671 Original CRISPR GAACAGTCTTTGGCCCAAAC AGG (reversed) Intronic
900793032 1:4692009-4692031 GAACAGCCTTTGCCCCAGGCCGG + Intronic
901896290 1:12315675-12315697 CAACAGTCTTTGGACCTATCAGG + Intronic
902674224 1:17997337-17997359 GACCAGTCTTCTGGCCAAACTGG + Intergenic
903708580 1:25305243-25305265 GAAGAGTGTGTGGCCCAACCAGG + Intronic
903718530 1:25387168-25387190 GAAGAGTGTGTGGCCCAACCAGG - Intronic
904858197 1:33515752-33515774 GACAAGTCTGTGGCCCAGACAGG - Exonic
908124228 1:61014307-61014329 GAGCATTCTTTGGCCACAACCGG + Intronic
909892816 1:81029164-81029186 GAAGAGTCTTTGGCCAACAGAGG - Intergenic
910062846 1:83114279-83114301 TAATAGCCTTTGGCCCAGACTGG + Intergenic
911170503 1:94766475-94766497 GTACAGTCATTTGCCCAAATTGG - Intergenic
911625471 1:100119317-100119339 GAACAATCTTAGACCCAAAACGG + Intronic
915417654 1:155754454-155754476 GCACAGTCCTTGGCCCCATCTGG + Exonic
916204676 1:162304255-162304277 GAACAGTCTTTTCAACAAACAGG - Intronic
916894195 1:169144668-169144690 GAACAGTGAATGGCACAAACAGG + Intronic
916964091 1:169917477-169917499 GACCAGTCTTTATCCCAAATAGG + Intergenic
920624124 1:207579449-207579471 AAACAGGCTCTGGCCCAGACAGG + Intronic
1067781208 10:49208840-49208862 GTACAGTGTTTGGCACACACAGG + Intergenic
1074003874 10:109399358-109399380 GACCAGTCTGTTGCCCAGACTGG - Intergenic
1081665482 11:44914684-44914706 GAACAGTACTCGGCCCAAGCTGG - Intronic
1082100366 11:48168110-48168132 GAAGAGTCTTTGGAGAAAACTGG - Exonic
1084931964 11:72563003-72563025 GAACCATCATTGGCCCATACAGG + Intergenic
1092627278 12:10340234-10340256 GAACAGTCTGTATCTCAAACTGG - Intergenic
1095436936 12:42199616-42199638 AAACAGTCTATGGTCCTAACAGG + Intronic
1102059540 12:109922430-109922452 GAACAGCCTGTGGCCCACACTGG + Intronic
1106977091 13:35232232-35232254 GGACAGTCTTTGGCCCTTTCGGG + Intronic
1117566478 14:56999095-56999117 GAACAAGCTTTGGCAAAAACTGG + Intergenic
1118806275 14:69239932-69239954 GAAAAGTCTGTGGCCGAAAGGGG - Intronic
1125420871 15:39502840-39502862 GAACATTCTTTTTCCCAAATAGG - Intergenic
1127909948 15:63408338-63408360 GAAGAGTTTATGGTCCAAACGGG + Intergenic
1129900692 15:79146227-79146249 GATGAGTATTTGGCCCAAATTGG + Intergenic
1131867396 15:96726022-96726044 GAACAGTCTCTGGCACAAAGTGG + Intergenic
1134756283 16:16670315-16670337 CAGCAGTATTTTGCCCAAACTGG - Intergenic
1138217922 16:55221693-55221715 GAAGAGTCTTTAGCCCCAAGAGG - Intergenic
1140213024 16:72985778-72985800 GAGCAGTCTTCCGCCCAACCAGG + Intronic
1140451119 16:75071615-75071637 GAACAGTCCCAGGCCCACACAGG + Intronic
1140614186 16:76640173-76640195 AAACAGGATCTGGCCCAAACAGG - Intergenic
1148166588 17:45488342-45488364 GAACAGTGTTTGTCACACACTGG + Intronic
1149506573 17:57198984-57199006 GCACAGTATCTGGCCCATACAGG + Intergenic
1150397762 17:64834743-64834765 GAACAGTGTTTGGCACAGACTGG + Intergenic
1151628922 17:75296658-75296680 AAACAGTGTCTGGCCAAAACAGG - Intergenic
1154238221 18:12626248-12626270 GTACAGTTTTTGACCCAAACAGG - Intronic
1157232814 18:45935142-45935164 GAACAGTCCCTGGCACAGACTGG - Intronic
1160616575 18:80134861-80134883 GGACAGTGTTTGGCCCATGCAGG - Intronic
1165676028 19:37724428-37724450 TATCACTCTTTGGCCCAGACTGG - Intergenic
1168579230 19:57539829-57539851 GAACAGTAATTGGCCCAGACAGG + Exonic
925639651 2:5975166-5975188 GGACAGTCATGGGGCCAAACTGG - Intergenic
929932642 2:46270829-46270851 GAACAGGCTGTGGCCCCAAATGG + Intergenic
930340489 2:50107839-50107861 GAACAGTATTTGGCTCATAATGG + Intronic
931160461 2:59684540-59684562 GGCCAGTCTTTGGCCCACACAGG - Intergenic
934151576 2:89152462-89152484 GCACAGTCTGTGGCCCAGCCAGG + Intergenic
934215685 2:90029444-90029466 GCACAGTCTGTGGCCCAGCCAGG - Intergenic
937611423 2:123866127-123866149 GAACAGCGTTTGGCGCAAAATGG + Intergenic
944872638 2:203930063-203930085 GAATAGTCCATGGGCCAAACTGG + Intergenic
946005222 2:216519282-216519304 GCACATTCTGTGCCCCAAACAGG + Intronic
947939410 2:234036148-234036170 GACCAGTCTTTGGGCCCCACTGG - Intergenic
1169403390 20:5302922-5302944 GCACAGGCTTTGGGTCAAACAGG + Intronic
1170675062 20:18471362-18471384 GAACAGGCTGCGGCCCAACCTGG - Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1172971918 20:38879951-38879973 GAAAAGTCTGTGGCCCAGCCTGG + Intronic
1175392960 20:58638640-58638662 GATCAATCTTTGGCCTGAACCGG - Intergenic
1177055870 21:16300021-16300043 GAATAGGCTGTGGCCCAAGCAGG - Intergenic
1178247779 21:30970781-30970803 GAAAAGTATTTGGCCAAATCAGG - Intergenic
1178457009 21:32764500-32764522 GAACAACCTTTGGACAAAACAGG - Exonic
960667290 3:120122575-120122597 GCTCAGTCTGTGGCCCAAACTGG + Intergenic
961842365 3:129726075-129726097 GTACAGACTTTGGGCCAAAAGGG + Intronic
965484498 3:169262173-169262195 CAACAGTCTTTGTCCAAAAGTGG - Intronic
970480509 4:16468134-16468156 GAACAGTATCTGGCAAAAACAGG + Intergenic
974187275 4:58460298-58460320 GAGCAGAATTTGGCCCAACCTGG + Intergenic
978679195 4:111357910-111357932 CAACAGTCTTTGGAATAAACTGG - Intergenic
982046671 4:151454336-151454358 GAACAGTCTTTGGCCCAAACAGG - Intronic
985242206 4:187942564-187942586 GAACAGTCTTTAGGGCAAAAAGG - Intergenic
992197568 5:74354960-74354982 GAAATGTCTTTGTCCCCAACTGG - Intergenic
992829440 5:80580121-80580143 GAACAGCCTTTTCCCCAACCGGG - Intergenic
996400215 5:123054235-123054257 GAACAGTGTCTGGCCCAAGGAGG - Intergenic
996922158 5:128781247-128781269 AGACAATCTTTGGTCCAAACTGG + Intronic
997512316 5:134462159-134462181 GAGCTGTCATTGGCCCAAGCAGG + Intergenic
1001008664 5:168077358-168077380 GAACAGTGCTTGGCCCATAGTGG - Intronic
1001308073 5:170590254-170590276 GAAGTATCTTTGGCCCAAACTGG - Intronic
1001321386 5:170685134-170685156 GAAAAGTCTTAGGGCCAAATTGG - Intronic
1002840178 6:898629-898651 TAACAGTCTCTGGCCTAAGCTGG - Intergenic
1003704041 6:8503985-8504007 GAATATTCTTTGACCCAAAAAGG - Intergenic
1004278750 6:14260814-14260836 GAACTGTCTTTAGCACAAAGAGG + Intergenic
1005641235 6:27798448-27798470 GAACTGTCATTGGCATAAACTGG - Intergenic
1008951365 6:57163393-57163415 GCACAGTGTTTGGCACAAAATGG + Intronic
1016224182 6:141714477-141714499 GAACTGTCCTAGGCCAAAACAGG - Intergenic
1016524307 6:144983819-144983841 GAACAGTCTTTTGCTTAAAGTGG + Intergenic
1018718208 6:166551898-166551920 GAACAGTCTTGGGCACAGATAGG + Intronic
1019280948 7:199929-199951 CCACAGTCTTTGTCCCAATCTGG - Intronic
1023929624 7:44697427-44697449 GAACCATCTCTGGCCCAATCAGG + Exonic
1024787560 7:52925683-52925705 GAGCAGTGTGTGGCCCAGACTGG - Intergenic
1026629237 7:72023716-72023738 GACCATTCTTGGCCCCAAACTGG - Exonic
1032785636 7:135197439-135197461 GAGCAGGCTGTGGCCCACACTGG + Intronic
1033684168 7:143623609-143623631 GAACAGTGCTTGGCCCACAATGG + Intronic
1033687344 7:143702828-143702850 GAACAGTGCTTGGCCCACAATGG + Intronic
1033700444 7:143834014-143834036 GAACAGTGCTTGGCCCACAATGG - Intergenic
1037879869 8:22567297-22567319 GAACTGTCCTTGGCCCCCACAGG + Intronic
1045526904 8:102948742-102948764 GAAGACACTTTGGCCCAGACAGG + Intronic
1045547137 8:103139724-103139746 GAACAGTCTTTTGCCACAATAGG + Intronic
1047484342 8:125315270-125315292 GAACAGCCTAAGGCCCAACCAGG - Intronic
1057856070 9:98601744-98601766 GACCAGCCCTTGGCCCATACTGG - Intronic
1059304948 9:113346851-113346873 GAGCAGTCATTGGCCCTACCAGG - Intergenic
1060395836 9:123315744-123315766 TGACTGTCTTTGGCCCAGACTGG - Intergenic
1190179762 X:48182251-48182273 AAACAGGCTTTGGGCCATACAGG - Intergenic
1190190317 X:48271609-48271631 AAACAGGCTTTGGGCCATACAGG + Intronic
1190205320 X:48398183-48398205 AAACAGGCTTTGGGCCATACAGG - Intergenic
1190659054 X:52638101-52638123 AAACAGGCTTTGGGCCATACAGG + Intergenic
1190659293 X:52639948-52639970 AAACAGGCTTTGGGCCATACAGG - Intergenic
1190669503 X:52727291-52727313 AAACAGGCTTTGGGCCATACAGG + Intergenic
1190669914 X:52731113-52731135 AAACAGGCTTTGGGCCATACAGG - Intergenic
1190677440 X:52794323-52794345 AAACAGGCTTTGGGCCATACAGG + Intergenic