ID: 982055319

View in Genome Browser
Species Human (GRCh38)
Location 4:151543338-151543360
Sequence GCCCCTCACCACCAGCCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 254}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982055314_982055319 0 Left 982055314 4:151543315-151543337 CCCCCTCCAAAACTGTATGCTTA 0: 1
1: 0
2: 0
3: 10
4: 208
Right 982055319 4:151543338-151543360 GCCCCTCACCACCAGCCCATAGG 0: 1
1: 0
2: 4
3: 30
4: 254
982055315_982055319 -1 Left 982055315 4:151543316-151543338 CCCCTCCAAAACTGTATGCTTAG 0: 1
1: 0
2: 0
3: 15
4: 132
Right 982055319 4:151543338-151543360 GCCCCTCACCACCAGCCCATAGG 0: 1
1: 0
2: 4
3: 30
4: 254
982055316_982055319 -2 Left 982055316 4:151543317-151543339 CCCTCCAAAACTGTATGCTTAGC 0: 1
1: 0
2: 1
3: 11
4: 116
Right 982055319 4:151543338-151543360 GCCCCTCACCACCAGCCCATAGG 0: 1
1: 0
2: 4
3: 30
4: 254
982055318_982055319 -6 Left 982055318 4:151543321-151543343 CCAAAACTGTATGCTTAGCCCCT 0: 1
1: 0
2: 2
3: 10
4: 113
Right 982055319 4:151543338-151543360 GCCCCTCACCACCAGCCCATAGG 0: 1
1: 0
2: 4
3: 30
4: 254
982055317_982055319 -3 Left 982055317 4:151543318-151543340 CCTCCAAAACTGTATGCTTAGCC 0: 1
1: 0
2: 2
3: 14
4: 133
Right 982055319 4:151543338-151543360 GCCCCTCACCACCAGCCCATAGG 0: 1
1: 0
2: 4
3: 30
4: 254
982055313_982055319 30 Left 982055313 4:151543285-151543307 CCTTGTATGATAAACATGCTGTA 0: 1
1: 0
2: 1
3: 8
4: 148
Right 982055319 4:151543338-151543360 GCCCCTCACCACCAGCCCATAGG 0: 1
1: 0
2: 4
3: 30
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982055319 Original CRISPR GCCCCTCACCACCAGCCCAT AGG Intronic
900124749 1:1064459-1064481 GCCCCTCACCGCCACCCCCACGG + Intergenic
900415133 1:2531317-2531339 GCCCCCAACCACCGGTCCATGGG + Intergenic
900428518 1:2591495-2591517 CCCCCTCACCCCCACCCCAGTGG - Intronic
900904467 1:5543405-5543427 ACCCTTCATCACCAGCCCGTTGG + Intergenic
901636588 1:10673281-10673303 GATCCTCTCCGCCAGCCCATTGG - Intronic
901650461 1:10740032-10740054 GCCAATTACCACCACCCCATAGG + Intronic
901955734 1:12783978-12784000 GCACCTCACCAGCAACCCAGTGG - Intergenic
901979107 1:13020028-13020050 GCACCTCACCAGCAACCCAGCGG - Intronic
902002975 1:13208910-13208932 GCACCTCACCAGCAACCCAGCGG + Intergenic
902022200 1:13354674-13354696 GCACCTCACCAGCAACCCAGCGG + Intergenic
902930553 1:19728332-19728354 CACCCTCACAACCACCCCATGGG - Intronic
903006739 1:20303678-20303700 ACCCCTAACCACTACCCCATGGG + Intronic
904564991 1:31423618-31423640 ACCTCTCACCACCTGCCCAGAGG - Intronic
905851772 1:41280052-41280074 GCCCCTGACCTCCAGCCCCAGGG + Intergenic
905908041 1:41632844-41632866 GCCCCTCACCTCCAGCCATGTGG - Intronic
906005978 1:42470787-42470809 TCCCCTCACCCCCAGGCCCTGGG - Intronic
907052719 1:51340537-51340559 TCCCCTCCTCTCCAGCCCATTGG + Intronic
908892600 1:68863350-68863372 GCTCCCCACGACCTGCCCATCGG - Intergenic
910270587 1:85390126-85390148 ACCCCTAACCACCAGCAAATAGG - Intronic
910732359 1:90412030-90412052 GCCTCTCAACACCACCCCAATGG + Intergenic
911889383 1:103347670-103347692 CCCCCCCACCACCACCCCATAGG - Intergenic
914936962 1:151989879-151989901 GCCCCTCAGCCCCAGCCCCAAGG - Intronic
915349078 1:155213378-155213400 GCCCCTTACCTCCATCCCAGGGG - Exonic
915352265 1:155234005-155234027 GCCCCTTACCTCCATCCCAGGGG - Intergenic
917707483 1:177648967-177648989 GCCCCATACCACCTGCCCAGGGG - Intergenic
919188191 1:194181733-194181755 GCTCCTGTCCACCAGCCTATGGG + Intergenic
919620581 1:199860615-199860637 ACCTCTCACCCCCACCCCATTGG - Intergenic
919777741 1:201205256-201205278 CCCCCTCACCACCAGCCGGTGGG - Exonic
919978623 1:202628686-202628708 GCTCCCCTCCTCCAGCCCATGGG - Intronic
923056041 1:230426372-230426394 GCCCCTCACCTCCCGCCCGCCGG + Intergenic
1062803269 10:395765-395787 GTCCCTCACCTCCAGGACATAGG - Intronic
1062911476 10:1215127-1215149 CCCCCTGACCTCCAGCCCCTTGG + Intronic
1063424471 10:5940662-5940684 CCCCCCCACCACCAGCTCAGTGG + Intronic
1065513987 10:26506670-26506692 TCCCCTCCCCACCACCCCACAGG + Intronic
1068675179 10:59763122-59763144 GCCTCTCACCACCAGTCCTGGGG - Intergenic
1069621481 10:69840229-69840251 GCCCCTGACCCCCAGCACCTGGG - Intronic
1070325729 10:75387749-75387771 GCCCCTCACCCTCACCCCATTGG - Intergenic
1070580717 10:77717148-77717170 GCCCATCACCACCAGCCCTGGGG - Intergenic
1070695207 10:78557988-78558010 GCCCCTCTTCTCCAGCCCAATGG - Intergenic
1071308572 10:84322251-84322273 TCCCCTCTCCCCCAGCCCCTGGG - Intergenic
1071516014 10:86298493-86298515 GCCCCACACCCCCAGCACAGGGG - Intronic
1071516492 10:86301123-86301145 CCCCCCACCCACCAGCCCATGGG + Intronic
1071814573 10:89219737-89219759 GCCCCTGGCCAACAGCCCAGAGG + Intronic
1073112679 10:101071981-101072003 GCCCCTCCTCACAAGCCCAGAGG - Intergenic
1074103790 10:110374267-110374289 GACCCTCACCACCTCTCCATGGG - Intergenic
1075207189 10:120457627-120457649 GCCCCGCACCACCTGCCCGGGGG + Intronic
1075748531 10:124744390-124744412 GTCCCTCACTCCCCGCCCATCGG - Intronic
1076410443 10:130245218-130245240 CTGCCTCACCACCTGCCCATGGG - Intergenic
1076537144 10:131186977-131186999 ACCCCACACCTCCAGCCCTTAGG + Intronic
1076623831 10:131809606-131809628 CGCCCTCACCAACAGCCCACTGG + Intergenic
1076734522 10:132452755-132452777 ACCCCTCACCTCCTGCCCCTGGG + Intergenic
1079312538 11:19379158-19379180 TCTCCTCACCACCAGCCCCGTGG - Intronic
1080518929 11:33049684-33049706 GCACCTCACCTCCAGCCCTAAGG + Intronic
1080873833 11:36259338-36259360 GTCCCTCTCCACCAGCACAGTGG - Intergenic
1081589563 11:44411765-44411787 GTCCCTTACCTCCAACCCATAGG - Intergenic
1082794205 11:57368313-57368335 GGGCCTCACCCCCATCCCATGGG + Intronic
1083667531 11:64284129-64284151 ACACCTCACCCCCAGCCCACTGG - Intronic
1083901322 11:65644890-65644912 GCCCCACCCCACCAGCTCTTAGG - Intronic
1085177823 11:74506393-74506415 GCCACTCACTACCAGCCTAATGG - Intronic
1087800225 11:102495881-102495903 GCCCCTCCCAACCAGCCCATCGG + Intronic
1089072560 11:115711561-115711583 GCCTCTGGCCACCAGCCCTTTGG - Intergenic
1089366335 11:117923222-117923244 GCCCCCCACTTCCAGCCCAGGGG + Intronic
1090848974 11:130554668-130554690 GCCCCTCACCACCATCACCCTGG - Intergenic
1090990846 11:131815646-131815668 GCGCCTCTCCCCCAGCCCCTCGG + Intronic
1092003574 12:5050547-5050569 GACCCCCACCACCAGAGCATAGG + Intergenic
1092265275 12:6976262-6976284 ACCCCTCTCCACCCCCCCATGGG + Exonic
1094816025 12:34185881-34185903 TGCCAACACCACCAGCCCATGGG + Intergenic
1095363188 12:41368822-41368844 GCCACTGACCACCATCCCCTTGG - Intronic
1095552358 12:43458167-43458189 GCCCCTCCCCACCCCCCAATGGG + Intronic
1095741915 12:45616733-45616755 GCCCCTCAATCCCAGCACATTGG + Intergenic
1096536136 12:52276014-52276036 GCCCCTCCCCACCTACCCTTTGG + Intronic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1100620608 12:96268929-96268951 TCCCCCCACCCCCACCCCATAGG + Exonic
1102703420 12:114860305-114860327 TCCTCTCACCTCCAGCCCCTGGG + Intergenic
1103779105 12:123387922-123387944 GCCCCTGACTCCCAGGCCATGGG + Intronic
1104035665 12:125095577-125095599 GCCCCACTCCACCTGCCCCTGGG + Intronic
1106590773 13:31096830-31096852 GCACCTCATCACCAGCCAATGGG + Intergenic
1107116793 13:36755759-36755781 GCGCCTCACCTTCAACCCATGGG + Intergenic
1110349267 13:74488210-74488232 GCCCCTCACCACCCCCCAACAGG + Intergenic
1110886051 13:80636859-80636881 GCCACCCACCACAGGCCCATAGG + Intergenic
1114746691 14:25155933-25155955 GCCCCCTACCACCAGACAATTGG - Intergenic
1117418409 14:55519307-55519329 CACCATCACCACCAGCCCTTGGG - Intergenic
1119293710 14:73516633-73516655 GTCCCTAACCCCCAGGCCATGGG + Intronic
1119479586 14:74951215-74951237 TCCCCCCACCACCAGCCCCTAGG - Intronic
1120275820 14:82371083-82371105 TACCACCACCACCAGCCCATGGG - Intergenic
1121539178 14:94712233-94712255 GTCCCTCATCATCACCCCATGGG - Intergenic
1121811848 14:96898383-96898405 GCCCCTCCCCACCAGCCGGAAGG + Intronic
1122606279 14:102948846-102948868 GCCCTTCACCACCAGGCCAGGGG + Intronic
1124494238 15:30176606-30176628 GCTCCCCTCCTCCAGCCCATGGG - Intergenic
1124749332 15:32362039-32362061 GCTCCCCTCCTCCAGCCCATGGG + Intergenic
1125609498 15:40960986-40961008 ACCCTTCACCACCAGCCCAGCGG + Intergenic
1127722298 15:61715171-61715193 GCCCCTCAGCAGCAGGCCAGTGG - Intergenic
1128335864 15:66785479-66785501 GCCCATCACAACCAGGGCATGGG - Intergenic
1128679165 15:69635314-69635336 GCAACTCACCATCTGCCCATGGG + Intergenic
1129669554 15:77599664-77599686 GACCCTCACCCTCAGCCCCTAGG - Intergenic
1130375475 15:83325244-83325266 GCTCCCCACCCCCATCCCATGGG + Intergenic
1130609190 15:85345226-85345248 CCCACTCACCACTTGCCCATGGG - Intergenic
1131522473 15:93126883-93126905 GCCCTTCCCCACGAGCCCAGTGG + Intergenic
1132614697 16:834715-834737 CCCCCTCAACCCCAGCCCACAGG - Intergenic
1133136661 16:3717199-3717221 TCCCCTCGCCACCCGCCCATGGG - Intronic
1134043686 16:11086241-11086263 GCTCCTCCCCACCAGCCCCATGG - Intronic
1135833149 16:25796717-25796739 GCCTCGCAGCACTAGCCCATAGG + Intronic
1136109027 16:28053045-28053067 GCCCCACTCCTCCAGCCCCTTGG - Intronic
1136472986 16:30494268-30494290 GCCCCTCGATACCAGCACATGGG + Exonic
1137732312 16:50697875-50697897 TCCCCCCACCCCCAGCCCAGGGG + Intronic
1137765538 16:50975058-50975080 GCCCATCACCAGCTTCCCATGGG + Intergenic
1138429698 16:56960862-56960884 GCCCCTGGGCACCAGCCCTTGGG - Intergenic
1138514839 16:57530362-57530384 GCCACCCACCAACAGCCCCTTGG + Intronic
1141700734 16:85640906-85640928 TCCCCTGACCACCAGCCCTCTGG - Intronic
1142066793 16:88067466-88067488 GCCCCTCAGGACAAGCCCCTGGG - Intronic
1142188012 16:88703658-88703680 GCTGCTCAGCACCAGCCCCTGGG - Intronic
1143350994 17:6288265-6288287 GCCCCTCTCCACCCGCCCCCCGG + Intergenic
1143379511 17:6487289-6487311 TATCCTCACCACCACCCCATGGG - Intronic
1144638740 17:16926351-16926373 GCCCGGCACCCCCAGCCCAGGGG - Intergenic
1146254045 17:31378701-31378723 GCCCCTCCTCAACATCCCATGGG - Intronic
1146339541 17:32007492-32007514 GCCCCTCCCGCCCAGCCCCTCGG + Intergenic
1146884764 17:36463754-36463776 GCTCCCCCCCACCACCCCATAGG + Intergenic
1147923385 17:43932418-43932440 GCCCCTCACCACCATCCCCAAGG + Intergenic
1148340804 17:46872462-46872484 GCCCCTCACCACCATCCCCAAGG + Intronic
1148745179 17:49914105-49914127 TCCCTTCTCCACCAGCCCATGGG + Intergenic
1152257177 17:79246853-79246875 TCCCCCCACCCCCATCCCATTGG - Intronic
1152729251 17:81961592-81961614 GCCCCGCGCCCCCAGCCCGTCGG - Intronic
1154172959 18:12063899-12063921 GGCCCCCAGCACCAGGCCATGGG - Intergenic
1157173378 18:45428557-45428579 GCCCATGACCTCCAGCCTATAGG - Intronic
1158440530 18:57470864-57470886 TCCCCTCCCCACCAGCACAAAGG + Intronic
1159126885 18:64234509-64234531 GCCTCTCCCCTCAAGCCCATGGG + Intergenic
1159194862 18:65100479-65100501 GCCCCCCACCCCCAGGTCATAGG + Intergenic
1159860886 18:73647934-73647956 CTCCCTCACCTCCTGCCCATGGG + Intergenic
1161425322 19:4199777-4199799 GGCTCTCACCACCTGCCCCTGGG - Intronic
1162318931 19:9959605-9959627 GCCCCCCACCGCCAGGCCATAGG - Exonic
1162479543 19:10920585-10920607 GCCCACCACCACCAGCCCCAGGG - Intronic
1162533195 19:11247606-11247628 GCCCCTCCACACCAGCCCCCGGG - Intronic
1162953877 19:14087988-14088010 GCCCCTGGCCTCCAGCCCCTAGG - Exonic
1163390495 19:17027209-17027231 GCCCCTCACCAGGGGCCCCTGGG + Intergenic
1163448346 19:17360771-17360793 GTCCCCAACCCCCAGCCCATCGG - Exonic
1163828219 19:19535548-19535570 GGCATCCACCACCAGCCCATAGG - Exonic
1165958699 19:39517396-39517418 GCCCCTCCACACCAGCCCATGGG - Intronic
1166746964 19:45146060-45146082 GCCCCTCAACACCTGCCCTAGGG - Intronic
1166881134 19:45930815-45930837 TCCCCTCACCCCCTGCCCAGAGG + Intergenic
1167383602 19:49151899-49151921 GCCCCGCCCCACCAGCCTACCGG + Intronic
926432116 2:12798499-12798521 ATCTCTAACCACCAGCCCATAGG + Intergenic
926800413 2:16655258-16655280 GCCCCACACCCCAAGCCCAGAGG - Intronic
927040216 2:19222226-19222248 GCTGCTCACCACCTGACCATTGG + Intergenic
929060086 2:37914718-37914740 ACCCGTCTCCACAAGCCCATAGG + Intergenic
929189787 2:39129056-39129078 TCCCCTCCCCACCAGGCCCTGGG + Intergenic
932479183 2:72028455-72028477 GCCCCACACCACAGGCCCATGGG + Intergenic
933836947 2:86253492-86253514 GTCCCCCACCACCACCCCTTTGG + Intronic
934919120 2:98328052-98328074 GCCCCTTACCACAAGCCTCTGGG + Intergenic
935130682 2:100258725-100258747 GCTCCTCACTGCAAGCCCATGGG - Intergenic
936041421 2:109152780-109152802 GCACCCCACCATCAGGCCATCGG - Intronic
936344517 2:111665157-111665179 GCCCACCACCACCTGCCCACCGG + Intergenic
936449107 2:112620146-112620168 GGCCCGCACTGCCAGCCCATTGG + Intergenic
937095495 2:119232792-119232814 GCCCCCCACCACCTACCCCTGGG + Intronic
937135689 2:119550088-119550110 GCCCCTCCCCAACAACACATGGG - Intronic
937322128 2:120967136-120967158 GGGCAACACCACCAGCCCATGGG + Intronic
938296992 2:130184614-130184636 GCCCCTCTCCACCCTCCCTTGGG - Intronic
938461645 2:131501461-131501483 GCCACTCTCCTCCAGCCCAGGGG + Intergenic
940053130 2:149485096-149485118 GCCCCTCAGCACAAGCCAAAAGG + Intergenic
940890786 2:159033454-159033476 TCCCCTCTCCCGCAGCCCATGGG - Intronic
940986779 2:160058832-160058854 CCCCCACCCCACCACCCCATTGG - Intronic
941554379 2:166958185-166958207 GCCCCTCACCCACAGTCAATGGG - Intronic
944414311 2:199467758-199467780 CCCCCTCACCACCACCACGTTGG + Intronic
945725147 2:213465796-213465818 GGCCCACCCCAACAGCCCATGGG - Intronic
946329529 2:219001615-219001637 GCCTCTCAGCACCAGCCCGGGGG - Intergenic
946364396 2:219239766-219239788 GCCCCTCACCAATGGCCCATGGG + Exonic
947948224 2:234124787-234124809 GCCCCTCACCACCAGCCTCCAGG + Intergenic
947991996 2:234495761-234495783 GCCCCCCACCCCCAGCTCAGGGG - Exonic
1168953214 20:1816896-1816918 TCCCCTCCCCATCAGCCCTTAGG + Intergenic
1170584357 20:17723162-17723184 GCCCCACCCCTGCAGCCCATGGG + Intronic
1171438128 20:25139608-25139630 ACCCCTACCCACCAACCCATAGG - Intergenic
1172167121 20:32906310-32906332 GCCCCAAACCAACAGCCCACAGG - Intronic
1172283354 20:33723566-33723588 AACCCACACCACCAGCCCCTAGG + Intergenic
1172830439 20:37829475-37829497 GACCCTCACCATCATCCCAATGG - Intronic
1174335247 20:49855049-49855071 GCCCCTCGCCACCAGCCCCTTGG - Intronic
1174376193 20:50128252-50128274 GGCCCTCACCACCTGCTCCTGGG + Intronic
1174611543 20:51801837-51801859 CACCCTCTCCACCAGCCCCTTGG - Intronic
1175831448 20:61967166-61967188 TCCCCTCACCAGCAGCCCTCTGG - Intronic
1176135635 20:63520930-63520952 GCCCCTCGCCCCCCGCCCCTCGG - Intronic
1176360061 21:5987695-5987717 GTCACTCACCAGCAGCCCCTCGG - Intergenic
1176659707 21:9622915-9622937 ACTCCTCACCTCCACCCCATTGG + Intergenic
1179430309 21:41316885-41316907 CGCACTCACCACCAGCCAATGGG - Exonic
1179763457 21:43550855-43550877 GTCACTCACCAGCAGCCCCTCGG + Intronic
1180035349 21:45245512-45245534 GCCCCTCACCCCCACCCCATAGG - Intergenic
1180035371 21:45245578-45245600 ACCCCTCACCCCCACCCCATAGG - Intergenic
1180035386 21:45245614-45245636 ACCCCTCATCCCCACCCCATAGG - Intergenic
1180035402 21:45245650-45245672 ACCCCTCACCCCCACCCCATAGG - Intergenic
1180035416 21:45245686-45245708 ACCCCTCACCCCCACCCCATAGG - Intergenic
1180035432 21:45245722-45245744 ACCCCTCACCCCCACCCCATAGG - Intergenic
1180035445 21:45245758-45245780 GCCCTTCACCCCCACCCCATAGG - Intergenic
1180086251 21:45509264-45509286 GCCCCTCTCACCCAGCCCAGAGG + Intronic
1180635733 22:17261629-17261651 GGCCCTCACCACCACCCAGTTGG - Intergenic
1182065945 22:27431694-27431716 GCCACTGACCACCAGGCCAGAGG - Intergenic
1182713703 22:32338745-32338767 GCCTCACTCCACCAGCCCTTTGG + Intergenic
1182718143 22:32376509-32376531 TCCCCTGTCCACCAGCCCCTAGG + Intronic
1184492952 22:44820631-44820653 GCCCCTCACCCCAAGCACAAGGG - Intronic
1185253839 22:49820799-49820821 GCCCCTCACAACCACCCCAGAGG + Intronic
1185277665 22:49956801-49956823 GGCCCTCCTCCCCAGCCCATGGG - Intergenic
949336229 3:2978469-2978491 GCCCGTCTCCTCCAGCCTATTGG + Intronic
951362468 3:21741003-21741025 GCACCTCACCACCAGCCTTAAGG - Intronic
953907958 3:46877830-46877852 CCCACTCACCTGCAGCCCATGGG - Intronic
954236715 3:49262627-49262649 GCCCCTCAACAGGAGCCCTTTGG - Intergenic
954447722 3:50555558-50555580 GCCCCTCTCCCCCAACCCAAGGG - Intergenic
954627143 3:52028766-52028788 CCCCTCCGCCACCAGCCCATGGG + Intergenic
956873844 3:73443069-73443091 GCGCCCCACCACCGGCCCAGTGG + Intronic
961699868 3:128734768-128734790 GCCTTTCACCACCAGCCTTTTGG + Intronic
964732343 3:159880672-159880694 GCTACTCAGCACCAGCCTATTGG + Intronic
967496159 3:190146323-190146345 GCCCTCCCCCACCTGCCCATCGG + Intergenic
967879201 3:194287201-194287223 TCCCCTCACCCCCAGCCCCAAGG - Intergenic
968511350 4:997289-997311 GCCCCGCGCCCCCAGCCCAGCGG + Intronic
968733071 4:2280810-2280832 GCCCCGCAGCTCCAGCCCCTTGG + Intronic
969586569 4:8097470-8097492 TCCACTCACCACCAGGCCAGGGG - Intronic
969710944 4:8843083-8843105 GCTCTTCACCACCATGCCATCGG - Intergenic
972632893 4:40857212-40857234 GCGCCTCCCCAGCAGCCAATGGG - Intronic
975592730 4:76016847-76016869 GCCCATCACCACAGACCCATGGG + Intronic
977949992 4:102959701-102959723 GCCCCTGACCAACAGCACAGGGG - Intronic
982055319 4:151543338-151543360 GCCCCTCACCACCAGCCCATAGG + Intronic
984778626 4:183504996-183505018 CCCCCGCAGCACCAGCCCAGGGG - Exonic
984856371 4:184199361-184199383 GCCACTCACTAGCAGACCATGGG - Intronic
986712990 5:10501452-10501474 GACCCTCCCCTCCAGCCCTTAGG + Intergenic
986971757 5:13344898-13344920 GACCCTCTGGACCAGCCCATAGG + Intergenic
989625852 5:43428874-43428896 GCCCCACACCACCACCACAAAGG - Intergenic
991927381 5:71718973-71718995 GTCCCTCACCTCTAGCCCCTCGG + Intergenic
996902652 5:128560630-128560652 GCACCTCATCCCCATCCCATAGG + Intronic
997354036 5:133250930-133250952 TCCCCTCCCCACCGGCCTATTGG - Intronic
998295865 5:140968019-140968041 GCCGCTCACCACCAGTGTATAGG - Exonic
999189105 5:149733006-149733028 CACCCCCACCACCAGGCCATTGG - Intronic
1000005022 5:157175546-157175568 TCCTCTCACCACTAGCCCACAGG + Intronic
1001797215 5:174512670-174512692 GCCCCCCACCACCAGCCTCTTGG - Intergenic
1002105596 5:176878137-176878159 GCCCCTCACCCCCCGCCGCTGGG + Intronic
1005669052 6:28086297-28086319 GCCCCTCACCACAGTCCCATAGG - Exonic
1005813346 6:29532179-29532201 GCCCAGCTCCAGCAGCCCATGGG + Intergenic
1006148442 6:31972744-31972766 GCCCCTCACCAGCTGCCGGTCGG - Exonic
1006187180 6:32188169-32188191 GCTCCTCCTCACCAGCCCACTGG - Intronic
1006845112 6:37056362-37056384 CCCCCGCCCCAGCAGCCCATAGG - Intergenic
1007104589 6:39274734-39274756 ACCCCTATCCACCAGCCCAGTGG - Intergenic
1010752159 6:79627866-79627888 TCCCCTCACCCCCAGCCTAAAGG + Intergenic
1011636139 6:89375580-89375602 GCCCCTCCCCACCTGCCCAGTGG - Intronic
1014260214 6:119207807-119207829 CCCCCTCTCCACCAGACCAAGGG - Intronic
1014951252 6:127558528-127558550 GACACTCATCACCAGTCCATGGG + Intronic
1018475795 6:164140138-164140160 GGTCCTCACCACCAGCCTCTAGG - Intergenic
1018696925 6:166397724-166397746 CCCCCGCACCACCAGCCCAGTGG + Intergenic
1019010049 6:168837708-168837730 CACCATCACCACCAGCCCAGCGG + Intergenic
1019410497 7:904628-904650 GCTTCTGACCATCAGCCCATGGG + Intronic
1019517127 7:1445015-1445037 GCAGCTGACGACCAGCCCATCGG + Exonic
1019587676 7:1814000-1814022 GCCCCTGACCTCCAGCCTCTGGG + Intergenic
1021800849 7:24304998-24305020 GCCTCACACCACCAGCCACTGGG - Intergenic
1022370495 7:29766505-29766527 CCTCCTCACCTCCAGCTCATTGG + Intergenic
1025943381 7:66089203-66089225 GCCACCCACCATCAGCCCAGAGG - Intronic
1026490292 7:70857116-70857138 GGCGCTCTGCACCAGCCCATTGG + Intergenic
1028120806 7:87054762-87054784 ACCCATCTCCACCATCCCATAGG + Intronic
1028135878 7:87222442-87222464 GCTCTTCACCCCCAGCCAATAGG + Intergenic
1031871162 7:127091431-127091453 TCCCCCCACCACCATCCCACTGG + Intronic
1031871183 7:127091497-127091519 TCCCCCCACCACCATCCCACTGG + Intronic
1031871194 7:127091524-127091546 CCCCCCCACCACCATCCCACTGG + Intronic
1032042395 7:128574120-128574142 GACCCTTTCCACCAGCTCATGGG - Intergenic
1032190666 7:129763835-129763857 GCCCCTGGCCACCACCCCAGTGG + Intergenic
1032486373 7:132290473-132290495 TCCCCTCACCTCCTTCCCATTGG + Intronic
1033533000 7:142285039-142285061 CCACCTCAACACCATCCCATTGG - Intergenic
1034182117 7:149147322-149147344 GCCCCTCCCCCCCAGCTCTTGGG - Intronic
1034272689 7:149811115-149811137 GCCCCCCACCCCCAGCCCCTCGG + Intergenic
1035175192 7:157045336-157045358 GCCCCTCACCAGCAGGCTAGGGG + Intergenic
1036204052 8:6792576-6792598 GCCTCTCAACACCATCCCATTGG - Intergenic
1037682535 8:21109524-21109546 GCCAGTATCCACCAGCCCATGGG + Intergenic
1040291003 8:46124538-46124560 GCCCCTACCCAGCAGCCCAACGG + Intergenic
1041277611 8:56178978-56179000 CCCCCTCTCCACCTGCCCATAGG + Intronic
1046826141 8:118694401-118694423 GGCACTCAACACCAGCCCTTGGG - Intergenic
1047204060 8:122789374-122789396 GCGCCACCCCACCAGCCCCTGGG + Intronic
1048753437 8:137705249-137705271 GCCCCTCTCCTCCACACCATGGG - Intergenic
1049559030 8:143298386-143298408 CCACCTCACCACCGGCCCAGGGG - Intergenic
1050351058 9:4741413-4741435 GCCCCTCTCCACCGGCCGCTGGG + Intronic
1053347479 9:37388473-37388495 TCCCACCACCACCATCCCATGGG - Intergenic
1053462942 9:38284683-38284705 GCCCCGCACCCCCAGCCTGTGGG + Intergenic
1053785832 9:41652230-41652252 GCCCCTTACCCCCAGCCTCTGGG - Intergenic
1055131017 9:72774751-72774773 TCACTCCACCACCAGCCCATGGG + Intronic
1055611529 9:78030677-78030699 TCCCCACGCCACCACCCCATGGG + Intronic
1057458797 9:95239986-95240008 TGCCCTCACCAGCAGCGCATTGG - Intronic
1057546167 9:96021603-96021625 GCCCCACGCCACCCGCCCACTGG - Intergenic
1058547673 9:106078071-106078093 GCCCCTCACCCCCGTCCCAATGG + Intergenic
1058801283 9:108546741-108546763 GCCCCTCATTCCCACCCCATTGG + Intergenic
1059385164 9:113958850-113958872 TGCCCTAACCAGCAGCCCATCGG + Intronic
1060996324 9:127876573-127876595 GCCCCTCAGCAGCTGCCCATGGG + Intronic
1061444194 9:130628567-130628589 GCCCCTCATCCCCAGGCCTTGGG - Intronic
1203637266 Un_KI270750v1:124758-124780 ACTCCTCACCTCCACCCCATTGG + Intergenic
1187098481 X:16169695-16169717 GCCCCTCACTTCTAGCCTATGGG + Intronic
1187953856 X:24496693-24496715 GACCCCCACCACCATCCCCTTGG + Intronic
1188166531 X:26870806-26870828 GCCCCCCACCCCCAACCCACTGG + Intergenic
1197946660 X:131846413-131846435 TCCCCACCCCACCTGCCCATAGG - Intergenic
1199277677 X:145964943-145964965 AACCACCACCACCAGCCCATGGG - Intergenic
1199297343 X:146174161-146174183 GCACCACACCAACAGCCCACAGG + Intergenic