ID: 982062104

View in Genome Browser
Species Human (GRCh38)
Location 4:151614953-151614975
Sequence CTCACAGAGCACCCTACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982062104_982062105 25 Left 982062104 4:151614953-151614975 CCAGGAGTAGGGTGCTCTGTGAG 0: 1
1: 0
2: 2
3: 14
4: 165
Right 982062105 4:151615001-151615023 GTAAAGTCCTGATCTGTCACTGG 0: 1
1: 0
2: 0
3: 7
4: 88
982062104_982062106 26 Left 982062104 4:151614953-151614975 CCAGGAGTAGGGTGCTCTGTGAG 0: 1
1: 0
2: 2
3: 14
4: 165
Right 982062106 4:151615002-151615024 TAAAGTCCTGATCTGTCACTGGG 0: 1
1: 0
2: 1
3: 28
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982062104 Original CRISPR CTCACAGAGCACCCTACTCC TGG (reversed) Intronic
902412402 1:16219175-16219197 GACACAGAGCACCTTACTCAGGG + Intergenic
902814353 1:18907729-18907751 CACACAGATCACCCTAACCCCGG + Exonic
903312494 1:22470596-22470618 CTCTCAGAGTACCCTCCTACTGG - Intronic
903319073 1:22530997-22531019 CTCTCTGAGCTCCCTCCTCCTGG + Exonic
906457276 1:46007976-46007998 GACACAGAGAATCCTACTCCAGG + Intronic
912506731 1:110161706-110161728 CTCCCTGAGCACCCACCTCCTGG - Intronic
912832756 1:112968260-112968282 GTCACAGAGCTGCCTACTCCAGG + Intergenic
913178169 1:116294019-116294041 ATTGCAGAGCTCCCTACTCCTGG + Intergenic
916479841 1:165205233-165205255 CTCACCCAGCCCCCTACTCTGGG + Intronic
916632758 1:166634631-166634653 CTCACAGAGGAGGCTAATCCAGG - Intergenic
917950737 1:180031819-180031841 CTCACAAAGCACCCTAAGCAGGG - Intronic
919537695 1:198808785-198808807 CTTACAGAGCAACCTCCACCAGG - Intergenic
922074006 1:222224365-222224387 CTCTAAGAGCATCCCACTCCCGG + Intergenic
922989188 1:229891350-229891372 CTCACAAAGTACTCTACTCTAGG - Intergenic
924697802 1:246418693-246418715 GTCACCGAGCGCCCGACTCCGGG - Intronic
1065565909 10:27009248-27009270 CTCCCAGAGCACCTCCCTCCTGG - Intronic
1069720150 10:70544676-70544698 TTCACAGGGAACCCAACTCCTGG - Intronic
1074568313 10:114601592-114601614 CTCACTGAGGCCCCTTCTCCTGG - Intronic
1074866257 10:117545889-117545911 CTCACAGAGCTCCGTGCTCATGG - Intronic
1075818412 10:125284329-125284351 CTCACAGGGCACCAAACTTCAGG - Intergenic
1076202507 10:128569641-128569663 TCCACAGAGCCCCCTCCTCCGGG - Intergenic
1077224574 11:1434530-1434552 ATCACAGGGGACCCCACTCCTGG - Intronic
1077224594 11:1434585-1434607 ATCACAGGGGACCCCACTCCTGG - Intronic
1077224614 11:1434640-1434662 ATCACAGAGGACCCCACTCCTGG - Intronic
1077480385 11:2811840-2811862 CTCACTGAGCACCGTTTTCCAGG - Intronic
1078417429 11:11177446-11177468 CTCACAGAGCCCCCAGCCCCTGG - Intergenic
1078732027 11:13983482-13983504 CTCACAGAACAACCTCCTCAAGG + Intronic
1082680592 11:56163509-56163531 CTCAAACATCACACTACTCCAGG + Intergenic
1084122734 11:67078629-67078651 CCAGCAGATCACCCTACTCCAGG + Intergenic
1084683815 11:70682068-70682090 CTCACAAAGCACCCTCCAGCAGG - Intronic
1085023805 11:73225062-73225084 CCCTCACAGCACCCAACTCCTGG + Intronic
1087610934 11:100433227-100433249 TTCACATAGCACCCTCCCCCTGG - Intergenic
1088473968 11:110216167-110216189 CTCACACATCACTCTCCTCCGGG + Intronic
1089830201 11:121320687-121320709 CTCACACTGCATCCTACACCTGG + Intergenic
1089984914 11:122803821-122803843 CTTCCAGAGCACCGTATTCCAGG + Intronic
1090424167 11:126595395-126595417 CACACAGAGCCCCCCAATCCTGG - Intronic
1091422158 12:351202-351224 CTCCCCTAGCCCCCTACTCCCGG + Intronic
1096590609 12:52656623-52656645 CTCACAGTGCAGACTTCTCCAGG + Intergenic
1099298545 12:80861836-80861858 CTCACAGAGCTGCCTGCTCCAGG - Intronic
1101625747 12:106439568-106439590 CTCACAGAGCCTCCACCTCCTGG - Intronic
1105269934 13:18863237-18863259 CTCACAGAGCAAGATGCTCCAGG + Intergenic
1105922988 13:24982647-24982669 ATCCCAGAGCAGCCTTCTCCAGG - Intergenic
1106204880 13:27583567-27583589 CTCTTAGAGCAGCCTCCTCCAGG + Intronic
1106553026 13:30787874-30787896 CTCACAGAGCATCCTTCGCTGGG - Intergenic
1108583298 13:51845676-51845698 CTCACAAAGCAGCCTGCTTCAGG - Intergenic
1111707619 13:91770275-91770297 CTCTCAGAACACCCTACTTTTGG + Intronic
1112813535 13:103246975-103246997 CTCACAGAACAGCTTAATCCAGG + Intergenic
1113115822 13:106873876-106873898 CCCACAGGGCTGCCTACTCCTGG + Intergenic
1113861886 13:113491594-113491616 CACACAGACCACCCGACCCCGGG - Intronic
1202829432 14_GL000009v2_random:10728-10750 CTCACAGAGCAAGATGCTCCAGG - Intergenic
1124624619 15:31300729-31300751 CTAACAGAGCTCCCTGGTCCTGG + Intergenic
1124883687 15:33664239-33664261 CTCACTGAGTCCCCTTCTCCAGG - Intronic
1125059197 15:35398511-35398533 CTCTCAGCGCACCATCCTCCAGG - Intronic
1125469619 15:39990142-39990164 CCCACAGACCACCCTGGTCCAGG - Intronic
1125726909 15:41872821-41872843 CTCACGGAGCACCCATCTCCCGG - Intronic
1129264414 15:74386275-74386297 CCCCCACAGCACCCTTCTCCGGG - Intergenic
1129523967 15:76202476-76202498 ATCACAGAGCACCCCTATCCTGG - Intronic
1132602560 16:780162-780184 CTCACAGCCCACCTTATTCCAGG - Exonic
1133386514 16:5374439-5374461 CTCACAGGGCTCCCTCCTCCTGG - Intergenic
1133809907 16:9154009-9154031 CTCTCACTGCACCCCACTCCTGG + Intergenic
1134572578 16:15303907-15303929 CTCCCAGCGGACCCTCCTCCTGG - Intergenic
1134729804 16:16452115-16452137 CTCCCAGCGGACCCTCCTCCTGG + Intergenic
1134937627 16:18259781-18259803 CTCCCAGCGGACCCTCCTCCTGG - Intergenic
1136653801 16:31696579-31696601 CTCACAGGGCACCCTGCCCCAGG + Intergenic
1137445062 16:48526621-48526643 CTGACAGTGCGCCCTTCTCCTGG + Intergenic
1137583315 16:49647874-49647896 TTCTCATAGCACCCCACTCCTGG - Intronic
1137588030 16:49676004-49676026 CCCACAGTGCCCCCTTCTCCAGG + Intronic
1144034575 17:11353943-11353965 CTAAGAGAACCCCCTACTCCAGG + Intronic
1144219031 17:13083418-13083440 CTCACACAGCACCTTCCTACCGG - Intergenic
1147213234 17:38884322-38884344 CTCACAGATAACCCCTCTCCTGG + Intronic
1147215319 17:38895922-38895944 CTCCCAGAGGACCCCACTCCTGG - Intronic
1148046917 17:44749957-44749979 CTCACAGAGCTCCCTCCCCCAGG + Intronic
1151557896 17:74855832-74855854 GGCACAGAGCCCCCTCCTCCTGG + Intronic
1160246317 18:77162965-77162987 CTCAAGGAGCACCCTACTCCAGG - Intergenic
1160434351 18:78834078-78834100 CTGGCAGAGCACCCTCTTCCTGG - Intergenic
1160529661 18:79556257-79556279 CTCCAAGAGAACCCTACCCCAGG + Intergenic
1162128987 19:8513893-8513915 CTCGGAGAGCGCCCTACTTCCGG - Intronic
1162726820 19:12694949-12694971 CCCACTGGGCACCCTACTCGTGG - Intronic
1163377528 19:16942654-16942676 CTCACAGAGGACCCCACAGCTGG + Intronic
1164479131 19:28598085-28598107 CTCAGAGAGCACTCACCTCCTGG - Intergenic
1164772804 19:30824751-30824773 CTCCCATGACACCCTACTCCAGG + Intergenic
1164937912 19:32229383-32229405 CACACAGAGCAGCCCCCTCCAGG - Intergenic
1165445109 19:35852502-35852524 CTCACAGTGCAACCTCCCCCAGG + Intronic
1166747847 19:45150379-45150401 CTCTCACAGCACCCCACTCCTGG + Exonic
1167435348 19:49475629-49475651 CACACACAGCCCCCTCCTCCGGG - Intronic
1202643261 1_KI270706v1_random:117054-117076 CTCACAGAGCAAGATGCTCCAGG + Intergenic
929894298 2:45945142-45945164 CTCACACAGCAGCCTTCCCCAGG - Intronic
932294768 2:70615261-70615283 CTCCCAGAACCCCCCACTCCAGG + Intronic
932424321 2:71619564-71619586 CTCCCAGAGCCCCCTGCTCAAGG + Intronic
933172441 2:79138753-79138775 CTCAAAGACGGCCCTACTCCAGG - Intergenic
933703616 2:85273786-85273808 CCCACAGAGCTGCCTCCTCCTGG - Intronic
935289466 2:101597676-101597698 CTCACAGACCATTCTAGTCCTGG - Intergenic
937304689 2:120864111-120864133 CTCACAGAGCCTCCTCCTGCAGG - Intronic
943906519 2:193506113-193506135 GCCACAGAGCAGCCAACTCCAGG - Intergenic
948045004 2:234936769-234936791 CTCTCTGATCACCCTAATCCAGG - Intergenic
948298617 2:236885025-236885047 CTCACACAGCAGCCTTCCCCAGG - Intergenic
1171890384 20:30707257-30707279 CTCACAGAGCAAGATGCTCCAGG + Intergenic
1172083918 20:32363695-32363717 CTCAGAAAGCACCTTCCTCCAGG - Intronic
1172219782 20:33265825-33265847 CACACAGACCACCCTAGTACAGG + Intergenic
1172979668 20:38931439-38931461 CTCACAGATCCCTCTGCTCCAGG - Intronic
1174085453 20:48004733-48004755 CTCACAGACCACCCTGGCCCTGG - Intergenic
1174096348 20:48092584-48092606 CTCACAGTGCACCTTTCTACTGG - Intergenic
1174130767 20:48341999-48342021 CTCACAGACCACCCTGGCCCTGG + Intergenic
1175456119 20:59115816-59115838 ATCACAGCCCACCCTACTCCAGG - Intergenic
1176045782 20:63091965-63091987 CTCACAGAGCACCCCACAGAAGG + Intergenic
1176123183 20:63463381-63463403 CTCCCTGACCACCCTACTCCAGG + Intronic
1176442871 21:6792025-6792047 ATCACATAGCAGCCTACTGCTGG - Intergenic
1176608616 21:8855569-8855591 CTCACAGAGCAAGATGCTCCAGG - Intergenic
1176821026 21:13657027-13657049 ATCACATAGCAGCCTACTGCTGG - Intergenic
1178422968 21:32456835-32456857 CTCACAGAACACCCTCCTCCAGG - Intronic
1178752639 21:35319172-35319194 CTCACAGAGCTCACTTCTACTGG + Intronic
1180358701 22:11865384-11865406 CTCACAGAGCAAGATGCTCCAGG - Intergenic
1180379565 22:12126947-12126969 CTCACAGAGCAAGATGCTCCAGG + Intergenic
1181875261 22:25935662-25935684 CTCCCAGAGTACCCTCCTTCTGG + Intronic
1183616428 22:38948608-38948630 CTCACAGAGCTCCCCGCTGCTGG + Intergenic
1183616628 22:38949921-38949943 CTCACAGAGCTCCCCACTGCTGG + Intergenic
1183707519 22:39483570-39483592 CTTCCAGAGCAACCTACTCTTGG - Intronic
1184353794 22:43964624-43964646 ACCACAGAGCACCCTGCGCCCGG + Intronic
1184508654 22:44919031-44919053 CTCACCCTGCACCCTCCTCCTGG + Intronic
950335056 3:12187011-12187033 GGCACAGACCACCCTGCTCCAGG - Intronic
950423152 3:12910472-12910494 CTCAGAGAGCAGGCTACTGCTGG + Intronic
950642607 3:14358269-14358291 CACACACCGCACCCTAGTCCTGG - Intergenic
953843511 3:46408501-46408523 GCCACAGGGCACCCTCCTCCTGG - Exonic
953983649 3:47425674-47425696 CTGTCAGGGCAACCTACTCCCGG - Intronic
957800009 3:85066107-85066129 GACACAGAGCAACCTACTTCAGG + Intronic
961771732 3:129254978-129255000 CCCACAGAGCACCATGCTGCAGG + Exonic
968532379 4:1099514-1099536 CTCACCGATCCCCCTTCTCCTGG - Intronic
972039518 4:34574757-34574779 CTCACAGAGCACCTTAGCTCTGG - Intergenic
975294333 4:72715041-72715063 CTCCCACAGCACTCTACACCCGG + Intergenic
978162345 4:105564020-105564042 TTCACTGAGTACCCTAATCCAGG - Intronic
982062104 4:151614953-151614975 CTCACAGAGCACCCTACTCCTGG - Intronic
982131229 4:152230472-152230494 CTGACACAGCAGCCTGCTCCAGG - Intergenic
984986434 4:185334880-185334902 CTCACGGAGCACTCTGCTTCTGG + Intronic
1202770635 4_GL000008v2_random:202964-202986 CTCACAGAGCAAGATGCTCCAGG + Intergenic
986911804 5:12566700-12566722 CTGACAGAGCACACTGCCCCTGG + Intergenic
989999638 5:50877876-50877898 ATCACAGAGCACCCTGGACCAGG - Intergenic
992042515 5:72848925-72848947 CGCACAGAGCGCCCTCCACCCGG - Intronic
994025160 5:95073497-95073519 CTCACAGAACACCCTATGCTGGG - Intronic
996321532 5:122222508-122222530 CTGACATGGCACCCTACCCCTGG + Intergenic
997242231 5:132315767-132315789 CTCCCAGAGCACCCTATAACAGG - Intronic
998595164 5:143521754-143521776 CACACGGAGCACCATACTCGGGG - Intergenic
999247755 5:150164318-150164340 CTTAGAGAGCACCCTTCCCCCGG + Intergenic
1002190287 5:177474032-177474054 CTCACACAACACCCCACCCCTGG + Intronic
1002258531 5:177978033-177978055 ATCACAGAGCAGCCTGCTCCTGG - Intergenic
1002501336 5:179649513-179649535 ATCACAGAGCAGCCTGCTCCTGG + Intergenic
1003399904 6:5782741-5782763 ATCCCAGAGCAGCCTTCTCCAGG - Intergenic
1006068651 6:31480812-31480834 CTCACAGACCTCACTACTGCTGG - Intergenic
1007064602 6:38977212-38977234 CACCCAGGGCACCCTCCTCCTGG - Intronic
1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG + Intronic
1011965790 6:93156298-93156320 CTCTCAGGAAACCCTACTCCTGG - Intergenic
1012373602 6:98534751-98534773 CTTACAGTGCACCCTAACCCTGG - Intergenic
1020140849 7:5610758-5610780 ATCACAGAGGCCCCTCCTCCCGG - Intergenic
1021619630 7:22538432-22538454 TTCACTGAGAACCCTACTCAGGG - Intronic
1022504809 7:30903319-30903341 CTCCCTGAACACCCCACTCCAGG - Intergenic
1022579160 7:31531053-31531075 CTCCCAGAGCAGGCTCCTCCAGG + Intronic
1023014451 7:35953412-35953434 GTCAGACAGCTCCCTACTCCTGG - Intergenic
1024066545 7:45741594-45741616 GTCAGACAGCTCCCTACTCCTGG + Intergenic
1025029019 7:55540686-55540708 CTCACAGAGCACTCACCTGCAGG + Intronic
1028371634 7:90099168-90099190 TTCACTGAGAACCCTACTCAGGG + Intergenic
1035047479 7:155978155-155978177 CTCGCAGGGCAGCCTGCTCCAGG - Intergenic
1036665070 8:10732514-10732536 CTCAAATAGCTCCCTTCTCCTGG - Intronic
1036679278 8:10859146-10859168 TTCACAGAGTACCCACCTCCAGG + Intergenic
1041027656 8:53703559-53703581 CTTCCAGAGCACCTTCCTCCTGG + Intergenic
1044105335 8:88198037-88198059 CTCCCAGAGCCCCCTTCACCAGG - Intronic
1048369463 8:133765031-133765053 CTCACAGAGCAGCCTTCCTCTGG - Intergenic
1048889057 8:138931727-138931749 TTCACACAGCGCCCTGCTCCTGG + Intergenic
1049839354 8:144761083-144761105 CCCACAGCTCACCCTCCTCCAGG - Intergenic
1049844328 8:144792706-144792728 GTCACAGAGCGACCCACTCCGGG + Intergenic
1057817319 9:98305116-98305138 AACACAGATCACCCTACTGCAGG + Intronic
1058132593 9:101269728-101269750 CTCCCAGAGCACGCTGCGCCTGG + Intronic
1060031925 9:120222020-120222042 CTCACAAAGCCTCCTTCTCCAGG + Intergenic
1060668101 9:125445173-125445195 CTCACAAAGCGACCGACTCCAGG + Intronic
1061044925 9:128160006-128160028 CTCCCGGACCTCCCTACTCCTGG + Intergenic
1062264571 9:135681161-135681183 CCCACAGAGCACACTGGTCCTGG - Intergenic
1062452773 9:136622510-136622532 CTCACTCAGCACTCTAGTCCTGG - Intergenic
1203704014 Un_KI270742v1:20783-20805 CTCACAGAGCAAGATGCTCCAGG - Intergenic
1185455627 X:309274-309296 CTCACTCAGCACCCTACGGCCGG + Intronic
1190542621 X:51494757-51494779 CTCACAGGACACCCTATTCTAGG - Intronic
1191022424 X:55877172-55877194 CTCACTGAGCCTCCAACTCCTGG + Intergenic
1195415078 X:104611253-104611275 CCCACAGAGCACCTTCCCCCAGG + Intronic
1199854814 X:151751687-151751709 CTCACACAGCCCCATCCTCCAGG - Intergenic
1200764680 Y:7070445-7070467 CTCAAAGAGCAGCCCATTCCTGG - Intronic