ID: 982063504

View in Genome Browser
Species Human (GRCh38)
Location 4:151628423-151628445
Sequence AAGTGTAGATGAGCCCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982063504_982063506 0 Left 982063504 4:151628423-151628445 CCACTCAGGGCTCATCTACACTT 0: 1
1: 0
2: 0
3: 17
4: 161
Right 982063506 4:151628446-151628468 ATGTAGCAGATCTGGACATCTGG 0: 1
1: 0
2: 2
3: 7
4: 139
982063504_982063507 19 Left 982063504 4:151628423-151628445 CCACTCAGGGCTCATCTACACTT 0: 1
1: 0
2: 0
3: 17
4: 161
Right 982063507 4:151628465-151628487 CTGGTTTCTAAACTAATCTGTGG No data
982063504_982063505 -8 Left 982063504 4:151628423-151628445 CCACTCAGGGCTCATCTACACTT 0: 1
1: 0
2: 0
3: 17
4: 161
Right 982063505 4:151628438-151628460 CTACACTTATGTAGCAGATCTGG 0: 1
1: 0
2: 1
3: 8
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982063504 Original CRISPR AAGTGTAGATGAGCCCTGAG TGG (reversed) Intronic
900099953 1:957856-957878 AGGGGTAGATGAGCCCAGAAGGG - Intronic
901756183 1:11442978-11443000 GAGTTTGGCTGAGCCCTGAGTGG + Intergenic
902688516 1:18095052-18095074 AATTCAAGATGAGACCTGAGTGG + Intergenic
904600918 1:31672291-31672313 GAGAGCAGATGAGCCCAGAGTGG + Intronic
906514646 1:46431766-46431788 AAGTGAAGTTCAGCCCTGGGTGG - Intergenic
907239632 1:53074346-53074368 GAGTGGGGATGACCCCTGAGAGG - Intronic
907641413 1:56194021-56194043 AAATGTAGGTGAGCCCAGTGGGG + Intergenic
912168772 1:107071843-107071865 AAATGCAGATGAGGCCCGAGAGG - Intergenic
915211565 1:154313364-154313386 GAGTGGAGATGAGCCCCCAGAGG - Intergenic
915212695 1:154322335-154322357 GAGTGGAGATGAGCCCCCAGAGG - Intronic
915466711 1:156102607-156102629 AAATGGAGATGAGCACTGGGTGG - Intronic
915588220 1:156856582-156856604 AAGTGTAGCTGAGCCTAAAGGGG - Intronic
915924840 1:160008935-160008957 AAGTGAAGATGAGCTTTTAGTGG - Intergenic
916139167 1:161678670-161678692 AACTTCAGATGAGCCCTGAGTGG + Intergenic
917634402 1:176920673-176920695 CAGTGTGGCTGAGCCCTCAGCGG - Intronic
920856821 1:209669572-209669594 AAGGGTAAATGATTCCTGAGAGG - Intergenic
922609951 1:226919039-226919061 AATTGCAAATGAGCCCAGAGTGG - Intronic
923388549 1:233490498-233490520 AAATGTATATGAGTCCAGAGAGG - Intergenic
1063724438 10:8621482-8621504 AAGTGAAGATGAGCTGTCAGAGG - Intergenic
1064220752 10:13438718-13438740 AATTATAGAAGAGCACTGAGGGG + Exonic
1064464400 10:15564865-15564887 AAGTGGAGACAAGCCCTGGGGGG + Intronic
1068367319 10:56068136-56068158 CAGTGTGTATGAGTCCTGAGGGG + Intergenic
1068367510 10:56069179-56069201 CAGTGTATATGAGTCCTGAGGGG - Intergenic
1069291141 10:66781156-66781178 CAGTGCAGAGGAGCCCTGTGTGG + Intronic
1069875994 10:71563203-71563225 ATGTGAAAATGAGCCCAGAGAGG - Intronic
1070528978 10:77319646-77319668 AAGTGTGGCTGAGTGCTGAGTGG + Intronic
1070597239 10:77841175-77841197 AGGTCTAGCTGAGCCCTGCGGGG - Intronic
1072296510 10:94013850-94013872 ACTTGTAGATGATCCCTGGGGGG + Intronic
1074323948 10:112429860-112429882 AGGTGTACGTGAGCTCTGAGTGG - Intergenic
1075355138 10:121765254-121765276 AAGGGTGGATGAACCCTCAGAGG - Intronic
1075539416 10:123299719-123299741 AAGTGTGGCTGTGCCCAGAGGGG + Intergenic
1075723516 10:124600390-124600412 CAGTGAAGCTGAGCCCTAAGAGG - Intronic
1075907530 10:126094586-126094608 CATTCTAAATGAGCCCTGAGAGG + Intronic
1076633873 10:131870193-131870215 AAGTGCAGGTGAGCTCTGTGGGG + Intergenic
1076786033 10:132750505-132750527 CAGTGTAGGCGAGCGCTGAGGGG + Intronic
1080655776 11:34256960-34256982 GTGTGTAGATGAGCCCTGGTTGG - Intronic
1081077494 11:38694974-38694996 AAGTATAGCTAAGCCCTGTGTGG + Intergenic
1081178329 11:39956148-39956170 AATTGTAGATGAGGGATGAGAGG - Intergenic
1082058578 11:47841401-47841423 AAGTGGAGATGAATTCTGAGCGG - Intronic
1082932196 11:58619861-58619883 AAGTGTAAAAGGGACCTGAGAGG - Exonic
1084383866 11:68829962-68829984 AAGTGGACACGAGCCCTGAAAGG + Intronic
1088073278 11:105815684-105815706 AAATGTGGATGAGTCCTAAGAGG + Intronic
1089910005 11:122088555-122088577 AAGAGTTGATGAGTCCAGAGAGG + Intergenic
1090521822 11:127487974-127487996 ACTTGTAGATGAGTCCTGAGTGG - Intergenic
1090735580 11:129609943-129609965 AAGTGTGGGTGGGCCCTGATCGG + Intergenic
1090793311 11:130111396-130111418 AATTTTAGATTAGCCCTGATGGG + Intronic
1090919731 11:131197247-131197269 ATGGGTAGATGAGGCCGGAGGGG + Intergenic
1091304414 11:134528392-134528414 AAGGGTAGATGCGGCCTCAGCGG - Intergenic
1094475750 12:30839450-30839472 TCATGTTGATGAGCCCTGAGGGG - Intergenic
1094832339 12:34306102-34306124 AAGTGAAGATAAGGCCTGAAAGG + Intergenic
1095165998 12:38972778-38972800 AAGTGTAGCTGAGAGTTGAGGGG + Intergenic
1095648922 12:44583742-44583764 AAGTGTATTTGAGCCATGATGGG - Intronic
1096528945 12:52231519-52231541 AGTTGAAGATGAGCCCTGAGGGG + Intergenic
1097816661 12:64082099-64082121 AAGTGTAGATGAACGCTTATAGG + Intronic
1106217414 13:27715534-27715556 AAGGGGAGAGGAGCCGTGAGTGG + Intergenic
1106416509 13:29550290-29550312 AAGGGTAAATGAGTCCTGTGGGG + Intronic
1110281685 13:73700990-73701012 ATGTGTAAATGAGCCCTGAAAGG + Intronic
1111824010 13:93245807-93245829 AAGTTTACATGAGCCCCTAGGGG + Intronic
1116774709 14:49166331-49166353 AAGTGTAGATGCAGCCAGAGGGG + Intergenic
1118885214 14:69860302-69860324 AAGAGTAGCTGAGCACGGAGAGG - Intronic
1121091941 14:91188980-91189002 CAGTGGTGATGAGCACTGAGCGG - Exonic
1121461769 14:94085139-94085161 AAGGGTAGATGTGGGCTGAGGGG + Intronic
1125211273 15:37218060-37218082 AAGTGAAGATGACACCTGTGTGG + Intergenic
1128250655 15:66161723-66161745 AAGTGAGGATGAGCACTCAGAGG + Intronic
1128516416 15:68344689-68344711 AAGTTCAGCTGAGCCCTGTGTGG - Intronic
1129058357 15:72838615-72838637 AAGTGAAGAAGAGACATGAGGGG + Intergenic
1129118988 15:73383583-73383605 CAGGGTAGCTGAGCGCTGAGTGG + Intergenic
1130088500 15:80799238-80799260 AAGTGAGGATTAGCCCAGAGTGG + Intronic
1132020016 15:98352773-98352795 AATTCAAGATGAGCCTTGAGTGG + Intergenic
1132192365 15:99877694-99877716 AATTCAAGATGAGACCTGAGTGG - Intergenic
1138394566 16:56694040-56694062 AAGTTTTGAGGAGTCCTGAGCGG + Intronic
1138857481 16:60712028-60712050 CAGTGTGGATGAGCCCAGGGTGG + Intergenic
1140991133 16:80212750-80212772 AATTTTATATGACCCCTGAGAGG - Intergenic
1141106073 16:81234831-81234853 ATGGGTGGATGGGCCCTGAGAGG - Intergenic
1141743914 16:85913350-85913372 AAAGGTAGCTCAGCCCTGAGAGG + Intronic
1143492487 17:7292489-7292511 AAGTGCAGATGGGGCCAGAGGGG + Intronic
1143962333 17:10731049-10731071 ATGTGTAAATGAGCCCGGGGAGG - Intergenic
1146359043 17:32159391-32159413 AGGTGGAGCTGGGCCCTGAGCGG + Intronic
1146626205 17:34437392-34437414 CAGAGAGGATGAGCCCTGAGTGG + Intergenic
1147138674 17:38449525-38449547 AAGGGTGGAAGAGGCCTGAGGGG + Intronic
1148476388 17:47931500-47931522 AGGTGTGTAGGAGCCCTGAGCGG + Intergenic
1149781772 17:59403233-59403255 AAGTGTAGCTGGGCCCAGAATGG - Intergenic
1153954374 18:10083606-10083628 CAGTGTAGCTGAGCCCTGATTGG + Intergenic
1155073393 18:22335667-22335689 AAGTGCAGACTGGCCCTGAGGGG + Intergenic
1157186641 18:45546588-45546610 AAGTGTATCTTAGCCCTGAAAGG + Intronic
1157546556 18:48550572-48550594 GAGTGGAGAGGAGCCCAGAGGGG - Intronic
1157718224 18:49903984-49904006 AAGTGTGAATGAGCCCTAGGTGG + Intronic
1162963098 19:14140083-14140105 AATGGTAGATGAGGCCTGAGAGG - Intergenic
1164588979 19:29495792-29495814 AAGTGTAGATGAGCTCAGGTGGG + Intergenic
1164728834 19:30485937-30485959 AAGGGAAGATGAGCTCAGAGAGG + Intronic
925379160 2:3412623-3412645 AAGTGCAGGTGAGCTCTGACTGG + Intronic
928304543 2:30156729-30156751 GAGTGGAGATGAGTTCTGAGCGG - Exonic
929999262 2:46849918-46849940 AACTGGAGCTGAGCCCAGAGAGG + Intronic
932721907 2:74144758-74144780 AAGAGGAAATGAGCCCAGAGAGG - Intronic
937092684 2:119217045-119217067 AAGGGCAGAGGTGCCCTGAGAGG - Intergenic
942281919 2:174373996-174374018 TGTTGTAGAAGAGCCCTGAGAGG - Intronic
943685634 2:190814985-190815007 AAGTATAGGTGAATCCTGAGTGG - Intergenic
943840738 2:192576532-192576554 AAGTGTAAATCAGCTCTAAGAGG + Intergenic
945753585 2:213818676-213818698 AATTGTAGATGAGATTTGAGTGG - Intronic
947378604 2:229523130-229523152 AAGAGTGGATGAGGCCTTAGGGG - Intronic
947707674 2:232289727-232289749 AAGTGTAGACCATCTCTGAGTGG + Intronic
948051407 2:234982165-234982187 AAGTGTAGCTGGGCCGGGAGAGG - Intronic
1168913707 20:1469499-1469521 AGATGGAGATGAGCCCGGAGGGG - Intronic
1169111595 20:3037524-3037546 AAGTACAGATGAGCCCTGTGGGG - Intronic
1176115719 20:63431091-63431113 AAGGGTGGATGGGCCCTGGGAGG + Intronic
1176285685 21:5018205-5018227 AAGTGCAAATGAGCCCTCTGGGG + Intergenic
1179871496 21:44245270-44245292 AAGTGCAAATGAGCCCTCTGGGG - Intergenic
1181623811 22:24108523-24108545 ACGTGTATAAGACCCCTGAGTGG - Intronic
1181879830 22:25969360-25969382 AAAAGTAGATGAGCCCTAATGGG - Intronic
1182070179 22:27458051-27458073 AAGTGGAGATGAGCAGTGATGGG + Intergenic
1183354463 22:37350872-37350894 AAGGGTGGAGGAGTCCTGAGAGG - Intergenic
1184952613 22:47855026-47855048 AAGCTTAGATGAGCTCAGAGTGG + Intergenic
950694178 3:14684760-14684782 AACTGAAGGTGAGCACTGAGAGG - Intronic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
954964146 3:54595956-54595978 AAGAGTAAATGGGCTCTGAGTGG - Intronic
960901361 3:122557520-122557542 AAGCTGAGATGAACCCTGAGGGG - Intronic
961543903 3:127618823-127618845 TTGTGGAGATGAGCCCTGTGGGG + Intronic
966500663 3:180635258-180635280 AATTGTAGATGAGACTTGGGTGG + Intronic
967332997 3:188310752-188310774 AAGGGTAGCTGAGGCCAGAGTGG + Intronic
968448301 4:663470-663492 AAGGGCAGCCGAGCCCTGAGCGG + Intronic
968862551 4:3184361-3184383 CAGTGTGGAGGAGCCTTGAGAGG + Intronic
969092212 4:4703118-4703140 CACTGGAGATGAGCCCCGAGGGG + Intergenic
969312604 4:6362639-6362661 AAGTGGAGATGGGCACTGAGAGG - Intronic
969626370 4:8307719-8307741 AAGCCTAGATGGGCCCAGAGTGG - Intergenic
971838684 4:31803124-31803146 AAGTGGAGTAGAGCACTGAGTGG - Intergenic
975663097 4:76706953-76706975 GAGTGTGGATAAGCCCGGAGAGG + Intronic
982063504 4:151628423-151628445 AAGTGTAGATGAGCCCTGAGTGG - Intronic
982605375 4:157509712-157509734 AAGTTTGAATGAGTCCTGAGTGG + Intergenic
983701820 4:170605957-170605979 TAGTGCATGTGAGCCCTGAGAGG + Intergenic
984739244 4:183143427-183143449 AAGTATAGATGAACCCTGTTTGG + Intronic
986060972 5:4189514-4189536 CAGTGTAGCAGAGTCCTGAGTGG - Intergenic
989453432 5:41613713-41613735 AAGAGGAGATGAGGCCAGAGTGG - Intergenic
989535207 5:42555590-42555612 AAGTTTAGAGGAGCTCAGAGAGG - Intronic
992766294 5:80003931-80003953 AAGTGTAGCTGAGCACAGCGAGG + Intronic
996508623 5:124294569-124294591 AAGTGGAGATGTGCCCATAGTGG - Intergenic
996877434 5:128254815-128254837 CAGGGTAGATGAGCTCTGATTGG + Intergenic
997123052 5:131195972-131195994 CAGTCTAGATGAGACCTGAGGGG + Intronic
1001293923 5:170485616-170485638 AAGTGAAGCTCAGCCCTGAGAGG - Intronic
1008556070 6:52673661-52673683 ATGTGTGAATGAGCCCTAAGAGG - Intronic
1008918333 6:56814958-56814980 CAGTGTAGGTGAGACATGAGGGG + Intronic
1012378595 6:98591878-98591900 AGGTGCAGATGAGCCTGGAGAGG + Intergenic
1013252148 6:108344994-108345016 AAATGTAGAGGGCCCCTGAGAGG - Intronic
1013290644 6:108716386-108716408 AAGTTGAGTTGGGCCCTGAGAGG - Intergenic
1016049719 6:139518282-139518304 AAGTGCACATGTGCCCTGGGGGG - Intergenic
1017295581 6:152789980-152790002 TAGTTTATCTGAGCCCTGAGGGG - Intergenic
1017687168 6:156925166-156925188 CAGTATAGAGGAACCCTGAGGGG - Intronic
1017753991 6:157514301-157514323 AAGAGTAGATGGATCCTGAGAGG - Intronic
1018764872 6:166925369-166925391 CAGTGTAGATGAGGCCTGGGTGG - Intronic
1018764892 6:166925453-166925475 CAGTATAGATGAGGCCTGGGTGG - Intronic
1026604639 7:71805321-71805343 AAGAGTAGAGAAGACCTGAGTGG + Intronic
1029607058 7:101605566-101605588 AGGTGAAGTAGAGCCCTGAGAGG - Intergenic
1030346124 7:108434483-108434505 ATGTGTAGAAGAGACCTCAGGGG + Intronic
1031975119 7:128088856-128088878 AAGTGTAGGTGAGCTTTGAGTGG + Intronic
1032469062 7:132164884-132164906 AGGGATAGATGAGCCCTGAGAGG - Intronic
1033521208 7:142162300-142162322 AAGTGTATATGAGGTGTGAGTGG + Intronic
1034075495 7:148227209-148227231 GAGTGAAGATGAGGCCTGAGAGG + Intronic
1034085657 7:148320158-148320180 AACTGTACATCAGCCCTGGGAGG - Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1035959325 8:4119537-4119559 AAGTTTAGATGAGGCCTTAAGGG + Intronic
1036220124 8:6914450-6914472 AGGTGTTGATGAGGTCTGAGTGG - Intergenic
1040886298 8:52267160-52267182 CAGTGGGGATGAACCCTGAGGGG + Intronic
1042686293 8:71444567-71444589 AACCTAAGATGAGCCCTGAGTGG - Intronic
1042868976 8:73380411-73380433 AGGAGGAGATGAGGCCTGAGAGG - Intergenic
1045557510 8:103228852-103228874 ATGTCTAGCTGAGCCCTGAGGGG - Exonic
1047880777 8:129190538-129190560 TAGTTTAGATGAGACCTCAGAGG + Intergenic
1048503009 8:134995782-134995804 AAGTGAAGAAGAGCCTAGAGTGG - Intergenic
1052441373 9:28500058-28500080 AAGGGCAGATGACTCCTGAGCGG - Intronic
1056688273 9:88784422-88784444 AAGTGCAGAAGAGACCTCAGTGG + Intergenic
1057401511 9:94727102-94727124 GACTGGAGATGAGCCCTGTGGGG - Intronic
1057837568 9:98457655-98457677 AGGTGTAGCTAAGCCCTGAAAGG + Intronic
1059117345 9:111611548-111611570 AAGTGAAGATGGGCCCGGTGTGG - Intergenic
1186748961 X:12601879-12601901 AAGGGTAGAAGACCCCTGTGAGG - Intronic
1189053527 X:37672572-37672594 CAGTGCAGCTGAGCCCTGATTGG + Intronic
1189196727 X:39159863-39159885 ATGTGGAGATGAGCTTTGAGGGG - Intergenic
1190626596 X:52343570-52343592 GGGTGTAAATGAGGCCTGAGGGG - Intergenic
1190701415 X:52992259-52992281 GGGTGTAAATGAGGCCTGAGGGG + Intronic
1193865443 X:86725597-86725619 CAGTGTTGATGAGTCCTGAAGGG + Intronic
1196900416 X:120377354-120377376 AAGTGAAGATGAGCTCTGAAAGG + Intronic
1200132678 X:153859734-153859756 GAGTGTAGAGGAGTCTTGAGGGG + Intergenic