ID: 982068959

View in Genome Browser
Species Human (GRCh38)
Location 4:151678566-151678588
Sequence GACCTCACCGCGTTTAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 22}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982068959_982068965 7 Left 982068959 4:151678566-151678588 CCTTTCCTAAACGCGGTGAGGTC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 982068965 4:151678596-151678618 TTGACAGCCTCACTCGAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 71
982068959_982068963 3 Left 982068959 4:151678566-151678588 CCTTTCCTAAACGCGGTGAGGTC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 982068963 4:151678592-151678614 GTAGTTGACAGCCTCACTCGAGG No data
982068959_982068964 6 Left 982068959 4:151678566-151678588 CCTTTCCTAAACGCGGTGAGGTC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 982068964 4:151678595-151678617 GTTGACAGCCTCACTCGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982068959 Original CRISPR GACCTCACCGCGTTTAGGAA AGG (reversed) Intronic
900541252 1:3204017-3204039 GACCACACCGGGATTAGGAAGGG + Intronic
903583117 1:24387237-24387259 CAGCTCACAGGGTTTAGGAATGG + Intronic
921030192 1:211329512-211329534 GACCTCACAGCATGTAGGGATGG + Intronic
1063071290 10:2668712-2668734 GATCTCACTGGGATTAGGAAAGG - Intergenic
1066372400 10:34828547-34828569 GACCACACCACCTTCAGGAAAGG - Intergenic
1096154733 12:49335725-49335747 GGCCTCACGGAGTGTAGGAATGG - Intronic
1097496931 12:60351633-60351655 GAACTCACTGAGTTGAGGAAAGG - Intergenic
1140042758 16:71419900-71419922 GACCTCACCTGGTGTGGGAATGG - Intergenic
1145239102 17:21229242-21229264 GACCAAAACGAGTTTAGGAAGGG + Intergenic
1147486438 17:40819156-40819178 GACCTCACCCCGTTTAGTTCCGG - Exonic
1162475468 19:10896813-10896835 GTCCTCACCGCCTCTAGGATGGG + Intronic
935247599 2:101232766-101232788 CACCACACCGAGTTTAGGAGCGG + Intronic
951536454 3:23744798-23744820 GACCTCTCGGCATTTAGGGACGG - Intergenic
960121906 3:113955705-113955727 GTCCTCACCATGTTAAGGAAAGG - Intronic
967420943 3:189271994-189272016 GGCATCAGCGCGTATAGGAAAGG - Intronic
972317005 4:37936009-37936031 TACCTTACCTAGTTTAGGAAGGG - Intronic
975339392 4:73221762-73221784 GACCTAACAGCTTTTAGGAAAGG + Intronic
975502195 4:75099612-75099634 GACCTCACTGCCTTGAGGGAAGG - Intergenic
982068959 4:151678566-151678588 GACCTCACCGCGTTTAGGAAAGG - Intronic
986375318 5:7124995-7125017 GACCTCTCCACCTTTAGGGATGG - Intergenic
1001997744 5:176175359-176175381 AACCCCACAGGGTTTAGGAAGGG - Intergenic
1012137449 6:95577277-95577299 GAACTCACTGCCTTTAGAAACGG - Intergenic
1041187385 8:55314996-55315018 GAAATCACCTAGTTTAGGAACGG - Intronic
1044097283 8:88082275-88082297 GATCTCACGGCTTGTAGGAATGG + Intronic
1051418121 9:16863734-16863756 GACCTTACCTCTTTTAGGCAAGG - Intronic