ID: 982070358

View in Genome Browser
Species Human (GRCh38)
Location 4:151688846-151688868
Sequence CTGTCTCAGAGGAGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 1, 2: 12, 3: 59, 4: 436}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982070358 Original CRISPR CTGTCTCAGAGGAGGCAGAG GGG (reversed) Intronic
901167145 1:7229130-7229152 CTGGGGCAGAGGAGGGAGAGTGG + Intronic
901242083 1:7701321-7701343 CTGTTGCAGAGGAGGAAGAAGGG - Intronic
902454071 1:16519247-16519269 CAGTCTCAGAGTGGGGAGAGTGG - Intergenic
902564582 1:17302875-17302897 TTTTCTCAAAGGTGGCAGAGGGG + Intergenic
902691095 1:18110462-18110484 CTGCCTCCGAGGGCGCAGAGAGG + Intronic
903011712 1:20335809-20335831 CTGTCTCAGAGGTGATAGAAGGG + Intronic
903733617 1:25516271-25516293 CAGGCTCTGAGGAGGAAGAGAGG - Intergenic
904250135 1:29217521-29217543 CTGTCCCAGAGTGGGCAGTGGGG - Intronic
904472593 1:30745382-30745404 GTGCCTCAGTGGAGGCAGAGAGG + Intronic
904911504 1:33937614-33937636 TCCTCTCAGAGGAGGAAGAGAGG - Intronic
905035177 1:34913445-34913467 CTGCCTCGGAAGAGACAGAGAGG + Intronic
905052648 1:35065169-35065191 CTATCTCAGGGGTGGCAGCGGGG - Intronic
905199804 1:36307831-36307853 TTGGCTCAGAGTAGGCACAGAGG + Intronic
906661531 1:47586311-47586333 ATGTCTCAGAGTTGGAAGAGGGG - Intergenic
906673519 1:47677166-47677188 TGGTCTCAGAGGCTGCAGAGTGG - Intergenic
909684766 1:78335441-78335463 CTTTCTTAGAGGAAGGAGAGTGG + Intronic
910500704 1:87886987-87887009 CTGAATAAGAGGAGGGAGAGAGG - Intergenic
912518702 1:110231198-110231220 CTGGCTGACAGGAGCCAGAGGGG + Intronic
912602001 1:110945428-110945450 CCGTCTCAAAGGAAGGAGAGAGG - Intergenic
912924708 1:113904007-113904029 CTGTCTCAAATGAGGCAAAGTGG + Intronic
912950257 1:114115891-114115913 CAGTCCCAGAGGAGGCTGGGTGG - Intronic
913014549 1:114719294-114719316 CTGTCTCTGGGGAAGCAAAGCGG + Intronic
913393466 1:118340357-118340379 CTGTCTCAGAGTAGACATAAGGG + Intergenic
914086038 1:144455447-144455469 GTGTTTCAGAGGAGGAAGAAGGG - Intronic
914191931 1:145419398-145419420 GTGTTTCAGAGGAGGAAGAAGGG - Intergenic
914489469 1:148142327-148142349 GTGTTTCAGAGGAGGAAGAAGGG - Intronic
914589836 1:149097348-149097370 GTGTTTCAGAGGAGGAAGAAGGG - Intronic
915276019 1:154788701-154788723 CTGGCTCACAGGAGGCTGTGGGG - Intronic
915523437 1:156462160-156462182 CTCCCTCAGTAGAGGCAGAGAGG - Intergenic
915699800 1:157781060-157781082 GTGTCTGAGGGGAGGCAGAGAGG + Intergenic
915906632 1:159882850-159882872 CTGGCTCAGGGGAGAGAGAGTGG - Intronic
916271071 1:162942260-162942282 CTTTCACAGAGGTGACAGAGAGG + Intergenic
917241806 1:172956727-172956749 CTGCCTCAGGAGAGGCAAAGGGG - Intergenic
918710363 1:187719758-187719780 GCCTCTAAGAGGAGGCAGAGGGG - Intergenic
919144927 1:193621823-193621845 CTGTCTCAAAAGAGGGAAAGTGG - Intergenic
919664913 1:200282697-200282719 CTGACTCACATGAGGCAGAGAGG + Intergenic
919786852 1:201263598-201263620 CAGTCTCAGAGGTGGGAGTGGGG + Intergenic
919974627 1:202602631-202602653 CCGTCCCAGAGGAGGCAGTTGGG + Intronic
919974787 1:202603358-202603380 GTGTCTCAGAGGCAGGAGAGTGG - Intronic
920722062 1:208397065-208397087 AGGTTTCAGAGGAGGCAGAATGG + Intergenic
921929833 1:220746215-220746237 CTTTCTCAGAGCAGCCAGAATGG + Intergenic
921949812 1:220917608-220917630 GTGTTTCAAAGGAGGCTGAGAGG + Intergenic
922124775 1:222711976-222711998 CTGTCCCTGCGGAGGCGGAGAGG + Intronic
923166792 1:231372138-231372160 CTAATTCAGAGGAGGAAGAGTGG - Intronic
924294674 1:242573944-242573966 CTATCTCAGAGGAGGCAGAGAGG + Intergenic
1063375571 10:5552389-5552411 CTGGCTTAGAGGATGCAAAGGGG - Intergenic
1063997323 10:11632110-11632132 CTGTCTCCGAGGCTGCAGTGCGG - Intergenic
1064246384 10:13670852-13670874 CTGGCACAGAGGAGGCAGGCAGG - Intronic
1064963769 10:20994902-20994924 CTGTCTCAGGAGTGGCAGAGAGG + Intronic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1066259926 10:33719627-33719649 CTGGGACAGAGGTGGCAGAGAGG + Intergenic
1066523522 10:36249656-36249678 GTGTCTCAGTGGATGAAGAGAGG - Intergenic
1066579304 10:36862522-36862544 AGGTCTCAGAGCAGGCACAGTGG - Intergenic
1067255524 10:44635093-44635115 GTGTCTCAGGGGTGGCAGAGGGG + Intergenic
1067801586 10:49362891-49362913 CTGTCTGAGAGCAGGCCCAGTGG - Intergenic
1069414531 10:68186235-68186257 CAGTTTGAGACGAGGCAGAGAGG + Intronic
1070827408 10:79399312-79399334 CTTTCTGGGAGGAGGCAGGGGGG - Intronic
1072390986 10:94986800-94986822 CTACCTCAAAGGAGGCAGAGAGG + Intronic
1072548274 10:96457253-96457275 CTTTCCCTGAGGAGGCAGGGAGG - Intronic
1072798496 10:98375043-98375065 CAGTCTCAAAGCAGGTAGAGGGG + Intergenic
1073883466 10:108009594-108009616 TTGTCTCTGAGGAGGGTGAGGGG - Intergenic
1075045735 10:119145160-119145182 CTGTCTCAGGGGTGACTGAGGGG - Intronic
1075122722 10:119675928-119675950 CTGTCTCAAAGAAGGAAGGGAGG - Intronic
1075288360 10:121206650-121206672 CTGTCTCAGAGGTGGATGAGGGG + Intergenic
1075411199 10:122229327-122229349 CTGTCTGAAAGCCGGCAGAGAGG - Exonic
1075549736 10:123383400-123383422 TTGTGACAGTGGAGGCAGAGAGG + Intergenic
1076466334 10:130684602-130684624 CTGTCTCAGATGGGCCAGCGAGG - Intergenic
1076746301 10:132516362-132516384 CAGTCTCACAGGAGGCATTGTGG + Intergenic
1077453548 11:2664753-2664775 GGGTCTCACAGGGGGCAGAGTGG + Intronic
1077478121 11:2800502-2800524 CAGCCTCAGAGCAGGCAAAGTGG - Intronic
1078351905 11:10601826-10601848 CTGGCCCAGTGGAGCCAGAGAGG + Intronic
1079130113 11:17742319-17742341 TTGTCTCAGAGGTGGGGGAGGGG + Intronic
1079873127 11:25824876-25824898 CTGAGTCAGAGGATGCAGAGAGG - Intergenic
1079881931 11:25939220-25939242 CTGTCCCAAAGGAGACAGAAGGG - Intergenic
1080309970 11:30878447-30878469 CTGTCTCAGAAAAGAAAGAGGGG + Intronic
1081855468 11:46300543-46300565 CTGACTTAGAGGAGACAGTGGGG + Intronic
1081906266 11:46672412-46672434 CTGGCTCAGAGCAGGATGAGGGG - Exonic
1083341155 11:61959287-61959309 CTGGCTCAGAAGAGTTAGAGGGG + Intronic
1083747161 11:64742938-64742960 CTGTCCCGGGAGAGGCAGAGCGG + Intronic
1083803422 11:65059531-65059553 CTGTCCCAGAGGAGGCAGCAGGG + Intergenic
1084670828 11:70605649-70605671 CTCTCTCCAAGGAGGCGGAGGGG + Intronic
1084823240 11:71708918-71708940 CTCTCTCAGTGGTAGCAGAGGGG - Intergenic
1085122353 11:73975208-73975230 CTGTCCCAAAGGAGGCTGGGAGG + Intronic
1085467116 11:76731567-76731589 CTGTCTCAGTGGTGGCATGGAGG - Intergenic
1085829714 11:79886468-79886490 CTTTCTCTGAAGAGGCAGAATGG + Intergenic
1086100374 11:83092967-83092989 CTGACTCAGAGCTGGCAGATGGG + Intergenic
1086193657 11:84110702-84110724 CTGGCTCAGAGGAGCCATTGGGG + Intronic
1086392051 11:86375216-86375238 CTGGCTCAGCGAGGGCAGAGTGG - Exonic
1086464293 11:87037735-87037757 CTGGGTGAGCGGAGGCAGAGAGG - Intergenic
1086951888 11:92899068-92899090 CTGTCTCAGTGGAGTCACACAGG + Intergenic
1087903764 11:103671966-103671988 CTGTCTGTGAGGAGTCAGTGGGG + Intergenic
1089174249 11:116536831-116536853 TTGTCTCAGATGAGGCAGTGGGG - Intergenic
1089244548 11:117109543-117109565 GTGTCTCTGAGTAGGCAAAGTGG - Intergenic
1090275792 11:125418507-125418529 CTGGCTGGGGGGAGGCAGAGCGG + Intronic
1090349944 11:126101469-126101491 CTGGGCTAGAGGAGGCAGAGGGG + Intergenic
1091318977 11:134636367-134636389 AAGTCTGAAAGGAGGCAGAGAGG - Intergenic
1091686695 12:2567514-2567536 CAGGGCCAGAGGAGGCAGAGAGG - Intronic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1092006014 12:5071171-5071193 GTAGCTCAGAAGAGGCAGAGGGG - Intergenic
1094247119 12:28311335-28311357 CTGTGTCAGAGGAAGCTGAGTGG - Intronic
1095103463 12:38205256-38205278 TGGTCTCAGAGCAGGCAAAGGGG + Intergenic
1095548369 12:43400244-43400266 CTGTCTCAGAGGAATGAGAAAGG - Intronic
1096594817 12:52688204-52688226 CTGTCTGAAGGGAAGCAGAGAGG - Intergenic
1097247723 12:57615773-57615795 ATGTCTCAGAGGAGCCAGGGAGG + Intronic
1097278575 12:57830050-57830072 CTGGCTTAGTGGAGGCAGAACGG + Intronic
1098337180 12:69416102-69416124 CTACCTCAGTGGAGGAAGAGTGG + Intergenic
1098676162 12:73292698-73292720 ATGTATCAGAAGAGACAGAGTGG + Intergenic
1098903815 12:76140894-76140916 CTGTCTCAGGGATGGCAGTGGGG - Intergenic
1099176778 12:79431270-79431292 CTGTCTCTGAGAAGTGAGAGTGG - Intronic
1100984470 12:100190944-100190966 CTGGCTCAAAAGAGTCAGAGGGG + Intergenic
1101863342 12:108500441-108500463 CTCTGCCAGAGGAGGAAGAGTGG - Intergenic
1102145901 12:110654962-110654984 CTGACCCAGAGATGGCAGAGTGG + Intronic
1104500539 12:129281703-129281725 CTTTCACAGTGGATGCAGAGAGG - Intronic
1105286623 13:19009382-19009404 CAGTGACAGAGAAGGCAGAGGGG + Intergenic
1105830066 13:24156374-24156396 CTGTCTCCGAGCAGACAGGGAGG + Intronic
1106787779 13:33124199-33124221 CTTTTTCACAGGAGCCAGAGAGG + Intronic
1108148956 13:47511437-47511459 AGGTCACAGACGAGGCAGAGAGG + Intergenic
1110090941 13:71447310-71447332 CTGTGTCTGAGGAGACAGACAGG + Intronic
1111822972 13:93235565-93235587 AGGTCTCAGAGGAGGATGAGAGG + Intronic
1112390499 13:98979401-98979423 AGGGCTCAGAGGAGGCAGTGGGG + Intronic
1112735317 13:102409501-102409523 GTGCCTCAAAGGATGCAGAGAGG - Intergenic
1113414947 13:110121517-110121539 CTGTGTCATAGGAGGAAGAGGGG + Intergenic
1113661252 13:112107730-112107752 CAGCCTCAGATGCGGCAGAGAGG - Intergenic
1115365534 14:32552965-32552987 GTGACTCAGAGAAGACAGAGTGG - Intronic
1115727652 14:36234838-36234860 CAGTCTTAGAAGAGGGAGAGAGG - Intergenic
1115784491 14:36808890-36808912 CACTTTCAGAGGAGGCAGAGTGG + Intronic
1116993326 14:51297992-51298014 CAATCTTAGGGGAGGCAGAGTGG + Intergenic
1117365259 14:55021018-55021040 CTGTCTCAGAGGTGGAAGAGGGG + Intronic
1117481557 14:56150844-56150866 TTGTCTCAGAGCTAGCAGAGTGG + Intronic
1117860880 14:60091786-60091808 CTGTCTTAACGCAGGCAGAGGGG - Intergenic
1118487089 14:66224524-66224546 CTGTCTTTGAAGAGGCAGAGGGG + Intergenic
1118803184 14:69209712-69209734 CGGTGTCTCAGGAGGCAGAGTGG + Exonic
1120665874 14:87306294-87306316 GGGTCTGACAGGAGGCAGAGGGG + Intergenic
1121339086 14:93094345-93094367 ATGGCTCAGAGGAGGCTGAGAGG + Intronic
1122377822 14:101277986-101278008 GCGTCTCAGTGGAGGCTGAGAGG + Intergenic
1122630700 14:103106548-103106570 CTGTCCCAGAGCTGCCAGAGGGG + Intronic
1124553554 15:30705966-30705988 CTGCCTCAGAGCAAGCAGTGTGG + Intronic
1125171522 15:36771061-36771083 GTGCCTCAGGGGAGGAAGAGAGG + Intronic
1125564672 15:40667588-40667610 CTGTTTCAGAAGAGGAAGAGAGG + Intergenic
1127707440 15:61561313-61561335 CTGCCACAGAGCAGCCAGAGTGG + Intergenic
1128614131 15:69096268-69096290 CAGTCTCAGGGGAGGCTGGGAGG - Intergenic
1129606925 15:77029512-77029534 CTGACTCTGAGGAAACAGAGGGG - Exonic
1130693848 15:86110540-86110562 CTGTCTCAGGGGTGGCAGAGGGG + Intergenic
1132665746 16:1080624-1080646 CTGTCTCAGAGAGGGGAGTGTGG + Intergenic
1133724004 16:8520821-8520843 CTGTCTCAAAAAAGACAGAGAGG + Intergenic
1134473414 16:14548946-14548968 CTGTCTCAGAAAAGGAAGAGGGG + Intronic
1135626835 16:24002852-24002874 GTCTCTCAGAGAAAGCAGAGTGG - Intronic
1135630948 16:24035308-24035330 CTGTCTCAAAGGAGGGAAACAGG + Intronic
1135754653 16:25086992-25087014 GCATCTGAGAGGAGGCAGAGAGG + Intergenic
1136158199 16:28399906-28399928 CCGACTCAGAGGAGGAAGAAGGG - Exonic
1136204888 16:28715377-28715399 CCGACTCAGAGGAGGAAGAAGGG + Exonic
1136672031 16:31867027-31867049 CAACCTCTGAGGAGGCAGAGAGG - Intergenic
1136930116 16:34410920-34410942 ATGTGGCAGAGGAGGGAGAGGGG - Intergenic
1136974458 16:35000885-35000907 ATGTGGCAGAGGAGGGAGAGGGG + Intergenic
1137542868 16:49377096-49377118 CTCTCGCAGGGGAGGCAGGGAGG - Intronic
1138079833 16:54079979-54080001 CTGGCTCAGAGGAGACAAAATGG - Intronic
1138215953 16:55205618-55205640 CTGCTACAGAGGAGGCAGTGTGG - Intergenic
1139506906 16:67403054-67403076 TTGTCTCAGCTGAGACAGAGAGG + Intronic
1139517761 16:67461870-67461892 CTGTCCCAGAGCAGGGAGTGGGG - Intronic
1139982419 16:70870626-70870648 CTTAATCAAAGGAGGCAGAGAGG - Intronic
1140051398 16:71484483-71484505 CTGCCTCAGTGGAGGGAGACAGG - Intronic
1141015752 16:80447628-80447650 GAGCCTCAGAGGAGGGAGAGGGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141173784 16:81706412-81706434 CTGGGTCAGTGGAGGCAGAGCGG + Intronic
1142299730 16:89249342-89249364 CACCCTCAGAGAAGGCAGAGTGG - Intergenic
1142375061 16:89702234-89702256 CTGTTTCAGACGAGGCTGAAAGG - Intergenic
1142629702 17:1216885-1216907 TTGTCTCAGAGGGCACAGAGTGG - Intronic
1143268392 17:5657749-5657771 CTTTCTCAGGGGAGCCTGAGAGG + Intergenic
1143472825 17:7186585-7186607 GTGTGTCAGAGAAGTCAGAGAGG - Intergenic
1145296020 17:21593196-21593218 CTGTCTCAGAGAGGGGAGATGGG + Intergenic
1145367769 17:22278866-22278888 CTGTCTCAGAGAGGGGAGATGGG - Intergenic
1146469788 17:33115014-33115036 CTGTCAAAGAGGGAGCAGAGAGG + Intronic
1146509184 17:33431009-33431031 CTATGTGAGAGGATGCAGAGGGG + Intronic
1146589220 17:34114041-34114063 CTGCCTCAGAGGAGACAGGAAGG + Intronic
1146683442 17:34824711-34824733 CTGGCCCAGAGGAGGGTGAGAGG + Intergenic
1147727146 17:42573013-42573035 CTGTCTCACAGGAGGAAGTTGGG - Exonic
1147734691 17:42628299-42628321 CTGTATTTGATGAGGCAGAGAGG - Intergenic
1148966009 17:51436787-51436809 CTTTCTCTGAGAAGGCAGAAAGG - Intergenic
1150446689 17:65231969-65231991 CTGTGTCAGAGAAGGGAGAGGGG + Intergenic
1150645614 17:66975941-66975963 CTGGCCCCAAGGAGGCAGAGAGG + Intronic
1150681863 17:67291068-67291090 CTCTCTCAGAGGTGCCAGACAGG - Intergenic
1150889366 17:69129176-69129198 CTTGTTCAGAGAAGGCAGAGCGG + Intronic
1150927314 17:69546427-69546449 TAATCTCAAAGGAGGCAGAGAGG + Intergenic
1151095787 17:71496282-71496304 CTGTCCCAAATGAGGAAGAGGGG + Intergenic
1151327457 17:73388034-73388056 CGGTCTGGGAGGTGGCAGAGGGG + Exonic
1151765352 17:76130856-76130878 GGGTCTCAGAGGAGGCAGGAAGG - Intergenic
1154312471 18:13277869-13277891 GTGACTGAGTGGAGGCAGAGGGG + Intronic
1154938867 18:21091121-21091143 TTGTATCAGGGGTGGCAGAGAGG - Intronic
1155054821 18:22173370-22173392 GAGTCACAGAGGTGGCAGAGTGG + Intronic
1155236345 18:23823355-23823377 TTGTCACGCAGGAGGCAGAGGGG - Intronic
1155498674 18:26466040-26466062 CTTTCTCGGAGAAGGCAGAGTGG - Intronic
1155498691 18:26466119-26466141 CTTTCTCAGAGAAAGCAGAGTGG - Intronic
1156323060 18:36046334-36046356 CTGTATCACAGGAGGCCTAGTGG + Intronic
1156992135 18:43421716-43421738 CATTCACTGAGGAGGCAGAGAGG - Intergenic
1157558814 18:48632015-48632037 GTGTCTCAGAGAAGGCAAACGGG + Intronic
1157607002 18:48932130-48932152 CTGGCTCAGAGGCTGCAGTGAGG + Intronic
1157742602 18:50106698-50106720 TTGTGTCAGGGGAGGCACAGAGG - Intronic
1159388632 18:67759391-67759413 TGGTGTCAGAGGAGGCAGAATGG + Intergenic
1159976007 18:74712596-74712618 CTGTCTCCCTGGAGGCAGGGAGG + Intronic
1160553465 18:79711163-79711185 CTGACAGAGATGAGGCAGAGAGG - Intronic
1160900170 19:1424041-1424063 CCGTCTCAGAAGATGCAGAAAGG - Intronic
1161399135 19:4059813-4059835 CTGCCTCCGAGGTGGGAGAGGGG + Intronic
1162226002 19:9223401-9223423 ATGTCACATAGGAGGCAGATAGG - Intergenic
1162534763 19:11256319-11256341 CTGCTCCAGAGGAGGGAGAGGGG + Intronic
1162890842 19:13732025-13732047 CTATCTCAGAGGAGGCTTTGAGG + Intronic
1163745559 19:19044362-19044384 CTGTCTCTGGGAAGCCAGAGGGG - Intronic
1163767438 19:19171248-19171270 CTGTGCCAGAGGAGTCAGGGAGG + Intronic
1164754996 19:30682682-30682704 CGGGCTGAGGGGAGGCAGAGAGG - Intronic
1165176430 19:33933791-33933813 CTGGCTCAGATGATGCACAGAGG - Intergenic
1165501730 19:36194827-36194849 CTGGGTCAAAGGAGGGAGAGAGG - Intronic
1166677158 19:44747445-44747467 CTGAGTCACAGGAGGCGGAGAGG - Intergenic
1166750746 19:45163021-45163043 GGGTGTCAGAGGAGGCAAAGGGG - Exonic
1167114439 19:47480461-47480483 CTGCCCCTGGGGAGGCAGAGGGG - Intronic
925591063 2:5510545-5510567 CTGTGACAGAAGAGGAAGAGAGG + Intergenic
925658493 2:6177427-6177449 CTGTCTCAGGGGTGGCAGAGGGG - Intergenic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
926088812 2:10036824-10036846 CTGTCCAAGAGGTGGCAGGGTGG + Intergenic
926723888 2:15982794-15982816 CCGGCTCAGAAGTGGCAGAGGGG - Intergenic
926994981 2:18724961-18724983 CAGTCTAGGAAGAGGCAGAGCGG + Intergenic
927172485 2:20381797-20381819 CTGTCCCAGAGGGAGCAGAATGG - Intergenic
927413856 2:22856281-22856303 CAGGCTCAGAGGAGAGAGAGTGG - Intergenic
927492108 2:23527431-23527453 CAGTCTCTGAGCAGGCAGAAGGG - Intronic
927656288 2:24949347-24949369 CCCTCTCTGGGGAGGCAGAGTGG - Intronic
929485993 2:42355195-42355217 GAGACTCAGAGGAGTCAGAGAGG + Intronic
929998754 2:46847012-46847034 CTTTCTCACAGGACACAGAGCGG - Intronic
930031469 2:47060685-47060707 CTGGCTCTGAGGATGCAGGGAGG + Intronic
930196899 2:48519257-48519279 CTGACTGAAAGGAGGCACAGGGG - Intergenic
930586470 2:53273299-53273321 TTATGTCAGAGGAGGGAGAGAGG + Intergenic
931502116 2:62880706-62880728 CTGTCTCATACCAGGCAGAATGG + Intronic
931712727 2:65003092-65003114 CTGTCACAGAGGAGGCGGGTGGG + Intronic
932817894 2:74876328-74876350 GTGTCTTAGAGGAGGCACATGGG - Intronic
933018282 2:77159678-77159700 CAGTCTCAGGGTGGGCAGAGGGG + Intronic
933554220 2:83811479-83811501 ATGTCTCAGAGTAGACAGATAGG + Intergenic
933688082 2:85159005-85159027 CTGTCTCAGAGTTGGCTGCGAGG + Intronic
934976551 2:98806624-98806646 CTGTCTCTGTGGAGGTAGAGTGG - Intronic
935720518 2:105975088-105975110 CTGGAGCAGAGAAGGCAGAGGGG - Intergenic
936040362 2:109145178-109145200 CTGTCTCAGAAGCAGCAGAAAGG - Intronic
936985116 2:118301920-118301942 AAATCTCATAGGAGGCAGAGAGG - Intergenic
937238102 2:120442652-120442674 CTGTCCCAGTGGGGGCAGAGTGG - Intergenic
937250141 2:120518612-120518634 CTGTCTGTGAGGGGGAAGAGAGG + Intergenic
937556104 2:123158631-123158653 CTGTTTCAAAGGAGTCAAAGTGG - Intergenic
938779489 2:134572414-134572436 TTGTCTAAGAGGAGGGATAGTGG - Intronic
939192098 2:138929133-138929155 ATGTCTCAGAGTAAGGAGAGGGG - Intergenic
939887018 2:147692087-147692109 CTGCCTCAGGGGTGGCAGAAGGG - Intergenic
942885578 2:180919597-180919619 TGGTGTCAGAGAAGGCAGAGTGG + Intergenic
943558823 2:189436844-189436866 CTGTCGCAGGGGTGGCCGAGTGG + Intergenic
943668435 2:190634942-190634964 ATGTGTCACAGGAGGCAGGGTGG - Intergenic
943788647 2:191907465-191907487 AGATCTCAGAGAAGGCAGAGGGG - Intergenic
944052363 2:195485041-195485063 CTGTCTCAGAGGTGGCAGACTGG + Intergenic
945529970 2:210940543-210940565 TTGTCTTAGAGAAGCCAGAGAGG - Intergenic
946046055 2:216821907-216821929 CTGGCTCTCAGGACGCAGAGTGG + Intergenic
946299601 2:218814583-218814605 CAGGCTCAGAGAAGGCAGTGGGG - Exonic
947885834 2:233570277-233570299 CTGTTTCAGGAGTGGCAGAGGGG - Intergenic
947895740 2:233670274-233670296 CTGTTTCAGGGGTGGCAGAGGGG + Intronic
948193669 2:236079124-236079146 CTGGCACATAGCAGGCAGAGGGG - Intronic
948595497 2:239076891-239076913 CTGGCTTAGAGGAGGCTGAAGGG - Intronic
1169049919 20:2567071-2567093 GTGTGCCAGAGGAGGCTGAGTGG + Intronic
1169448961 20:5695260-5695282 CTGTCTTAGAGAAGGCAGAGAGG - Intergenic
1169508902 20:6242933-6242955 CTGGCCAAGATGAGGCAGAGAGG + Intergenic
1169560712 20:6797860-6797882 CCCTGTCAGTGGAGGCAGAGTGG - Intergenic
1171013224 20:21519802-21519824 CTGTCTGTGGGGTGGCAGAGTGG + Intergenic
1171207324 20:23291073-23291095 CTGCCTCTGTGGAGGCAGGGAGG - Intergenic
1171399462 20:24862789-24862811 CTGCCTTAGAGAAGGCAGCGCGG + Intergenic
1171414504 20:24968485-24968507 CTTTCCCTGAGGAGGCAGAGAGG + Intronic
1172122500 20:32607313-32607335 CTGGCCCAGGGGAGGCTGAGGGG - Intronic
1172406474 20:34693570-34693592 CTGGCTCAGTGGAGGCACCGGGG + Intergenic
1172651522 20:36505920-36505942 CTGTCTCAGGGGTGGCAGATGGG + Intronic
1172709951 20:36914205-36914227 CTGTCTCAGGGGTGGCAGCGGGG - Intronic
1173132223 20:40404983-40405005 CTGTCTCAGAGGCAGCTGAGAGG + Intergenic
1173147459 20:40537083-40537105 CTGTCCCTGAGGAGGGAAAGGGG - Intergenic
1173434749 20:43022628-43022650 CTCTCCCAGAACAGGCAGAGAGG + Intronic
1173596382 20:44261103-44261125 CTTTCTCTGAGGAGGCAGAGAGG + Intronic
1173605635 20:44329251-44329273 CTGGCTCAGAGGAGGCATGAGGG - Intergenic
1174680703 20:52404729-52404751 CTGTATCAGAGGATTCAAAGTGG + Intergenic
1175010308 20:55728023-55728045 CTGTTGCAGAGGCAGCAGAGAGG - Intergenic
1176035063 20:63032122-63032144 CTGGATCAGAGGAGGGTGAGAGG + Intergenic
1176074445 20:63242051-63242073 CTGTTTCAGAGGAGGCCAGGTGG + Intronic
1176305897 21:5122989-5123011 CTGTCTCAGAGGGTGCAGAGTGG + Intronic
1176935462 21:14861457-14861479 CTGTCTCAGAGGAGGAGATGAGG - Intergenic
1177387471 21:20426169-20426191 CTGTCTGGGAGGAGAGAGAGAGG + Intergenic
1179170831 21:38971454-38971476 CTGACTCAGATGTGACAGAGAGG - Intergenic
1179804702 21:43829845-43829867 CTGTCACGGAGGAGGAAAAGTGG - Intergenic
1179851160 21:44139042-44139064 CTGTCTCAGAGGGTGCAGAGTGG - Intronic
1180165429 21:46023233-46023255 GTGTCGCAGATGAGGCAGTGAGG + Intergenic
1180180603 21:46117221-46117243 CTGTCTCCGGGGAGGCAGAGTGG - Intronic
1180872296 22:19153179-19153201 ATGTTTCAGAGGCGCCAGAGTGG - Intergenic
1181574257 22:23783740-23783762 CTGTCTCAGACTGGGCAGGGAGG + Exonic
1181584514 22:23845752-23845774 CTGGCTGAGAGGAGACAGCGAGG - Intergenic
1181615516 22:24051642-24051664 CTCCCTCAGAGTAGGCAGACAGG - Intronic
1182072803 22:27475466-27475488 CTGGTTCAGAGGTGGGAGAGGGG + Intergenic
1182108186 22:27704225-27704247 CTGGGTCTGAGGAGGCAGAGTGG - Intergenic
1182190361 22:28453768-28453790 CTGGGTCACAAGAGGCAGAGCGG - Intronic
1182995425 22:34807848-34807870 GCTTCTCAGAGGAGTCAGAGAGG - Intergenic
1183072802 22:35408144-35408166 CTTGCTGAGAGGAGGCAGACAGG - Intronic
1183390941 22:37545563-37545585 CTAGCTCAGAGGAGGCAGCCAGG - Intergenic
1183676278 22:39300540-39300562 CTGGAACAGAGGAGGCAGAGTGG + Intergenic
1184008347 22:41727775-41727797 CTGTCTCAGTGGAGTCACATGGG + Intronic
1184365400 22:44047916-44047938 CTGACTCAGGGGAGCCGGAGGGG - Intronic
1185399810 22:50609949-50609971 CCGGCTCAGAGAAGGGAGAGTGG + Intronic
949415568 3:3810314-3810336 ATATCACAGTGGAGGCAGAGAGG - Intronic
949697626 3:6717550-6717572 CTGTCTGAGAGGAGAGAAAGAGG - Intergenic
949748816 3:7327343-7327365 CCTTCTGATAGGAGGCAGAGGGG - Intronic
950088910 3:10280924-10280946 CTGTGTTAGAGGAGGAAAAGCGG + Exonic
954137439 3:48588504-48588526 GGGTCTGAGAGGAGGGAGAGGGG - Intronic
955058649 3:55477492-55477514 CTGTCTCAGAGGGTGTGGAGAGG + Intronic
955087413 3:55716746-55716768 CTGTGTCACAGGAGTCAGGGTGG - Intronic
955461566 3:59189393-59189415 CTGTTCCAGGGGAGGCAGCGGGG + Intergenic
955794298 3:62619620-62619642 CTCTCTAATGGGAGGCAGAGGGG - Intronic
956330451 3:68101160-68101182 CTGTATCAGAGGATGGAGGGTGG - Intronic
956386450 3:68724909-68724931 CTATCTCTGAGGAGGCCGAGTGG - Intergenic
956572159 3:70708981-70709003 CTGTCTCAGAGGAGCAGAAGTGG + Intergenic
956864540 3:73356263-73356285 CTGTTCCAGAGGAGACAGAGGGG - Intergenic
959279820 3:104323733-104323755 CTGTTTCAGTGGAGGTGGAGGGG - Intergenic
959317865 3:104832064-104832086 CTATCTCAGACCAGACAGAGTGG + Intergenic
959536561 3:107493007-107493029 CTGTCTCAGGCCAGGCACAGTGG + Intergenic
961077820 3:123998105-123998127 CTGTGTGAGGAGAGGCAGAGGGG - Intergenic
961200815 3:125043854-125043876 CTGGTTCCGAGGAGGAAGAGGGG + Intronic
961259338 3:125587932-125587954 CTGTCTCAGGCCAGGCACAGTGG + Intronic
961306750 3:125963230-125963252 CTGTGTGAGGAGAGGCAGAGGGG + Intergenic
961313176 3:126016685-126016707 ATGGCTGAGAGGAGGAAGAGGGG + Intronic
961393536 3:126570608-126570630 CTGTGTGAGGGGAGGCAGTGAGG - Intergenic
962833283 3:139162805-139162827 TTGTCTCAGGTGAGGCACAGAGG + Intronic
963015951 3:140823969-140823991 CTGCCTCAGTGGTGGCAGACAGG - Intergenic
963040217 3:141064882-141064904 CTGTCTCAGGGAAGGCAGTCTGG + Intronic
964172160 3:153783623-153783645 CAGTATTAGAGGAGGCAGGGAGG + Intergenic
964225625 3:154397267-154397289 CAGTCTAAGAGAGGGCAGAGAGG + Intronic
964670074 3:159215276-159215298 CTGTCTCTGAAGAGGAAAAGAGG - Intronic
965845352 3:172954581-172954603 CTCTCCCAGAAGATGCAGAGAGG - Intronic
966434637 3:179869631-179869653 GTGCTTCAGGGGAGGCAGAGGGG - Intronic
966903228 3:184502597-184502619 CTGCTACAGAGGAGGTAGAGAGG + Intronic
968906200 4:3452281-3452303 CTGTGTAAGAGAAGTCAGAGGGG + Intergenic
969695529 4:8732120-8732142 CTGACCAAGAGGAGGGAGAGAGG - Intergenic
970603180 4:17656160-17656182 ATTTCTCACATGAGGCAGAGAGG - Intronic
970863371 4:20730568-20730590 CTGGCGCATAGGAGGCAGGGTGG + Intronic
972610369 4:40650612-40650634 CTGTCTCAAAAGAAGAAGAGAGG - Intergenic
973267574 4:48226416-48226438 CTGTCTCAGGGGTGACAGAGGGG - Intronic
975274017 4:72473828-72473850 TGGTTTCAAAGGAGGCAGAGTGG + Intronic
975567830 4:75778452-75778474 CTGTTTCAGGGATGGCAGAGAGG + Intronic
976822016 4:89217241-89217263 CTAGCTGAGAGGAGGCAGGGAGG - Intergenic
976895214 4:90101176-90101198 CTGTGTCAGAGTAGCCAGAAAGG + Intergenic
978017468 4:103763089-103763111 CTATTTCAGAGTAAGCAGAGAGG + Intergenic
978617755 4:110613029-110613051 AACTCTCAGCGGAGGCAGAGAGG + Intergenic
980080465 4:128338793-128338815 GTGACTCAGAGGAAACAGAGTGG - Intergenic
980393503 4:132176676-132176698 CTGTCTCAGAGGAAAAATAGAGG - Intergenic
980720652 4:136690551-136690573 TTGTCTCAGATGAGTCAGAGGGG + Intergenic
981735263 4:147942923-147942945 CTGTCTTAGAGGCTGCAAAGGGG - Intronic
982070358 4:151688846-151688868 CTGTCTCAGAGGAGGCAGAGGGG - Intronic
982155277 4:152514193-152514215 CTGTCTCAGAAGAAGCTAAGTGG + Intronic
984594141 4:181648345-181648367 GTGGCTCAGAGGAGGCAAAGGGG - Intergenic
984632444 4:182075131-182075153 TTTTCTCAGACGTGGCAGAGTGG + Intergenic
984653290 4:182291547-182291569 CAGTCTCACAGGAGGCTGTGAGG - Intronic
984943325 4:184952675-184952697 CTGTCACAGAGGAGGAGGGGAGG + Intergenic
985307323 4:188557814-188557836 CTGTCTCAGGGGTGGCAGAGAGG - Intergenic
985338841 4:188925784-188925806 CAGGCTCAGAGGAGGACGAGAGG - Intergenic
985550652 5:531834-531856 CTGTTTCTATGGAGGCAGAGTGG - Intergenic
985571050 5:645246-645268 CTGCCCCAAAGGAGACAGAGCGG - Intronic
988455212 5:31381536-31381558 CTCTCTCTGAGGAGACAGAGGGG + Intergenic
988507233 5:31834012-31834034 CTGCATCAGAGGAGGAAGAGTGG - Intronic
989596933 5:43164953-43164975 CTGTTTCAAAGGAGAGAGAGAGG - Intronic
990292166 5:54363307-54363329 CCCTCTCAGAGGAGACAGTGAGG + Intergenic
990296359 5:54405683-54405705 CTTTGTCAGAAGAGGCTGAGTGG + Intergenic
990649922 5:57886916-57886938 CTGTCTCGCAGGGGGCAGGGGGG - Intergenic
991499406 5:67261864-67261886 CTGTCTCTGGAGTGGCAGAGGGG + Intergenic
992690383 5:79236004-79236026 CTGGCTCAGGGGACGCCGAGAGG + Intronic
992806252 5:80340747-80340769 AGGTCTCTGAGGAGGCAGTGGGG - Intergenic
993808549 5:92443226-92443248 AGGTGTCAGAGGAGGGAGAGAGG + Intergenic
993882790 5:93382397-93382419 CTGTGTAAAAGGAGGCACAGAGG - Intergenic
995047508 5:107669410-107669432 CTGTCCCAGAGAAAGCAGTGCGG + Intronic
995971922 5:117983102-117983124 CTGTCCTAGAGGAGGCACAGTGG + Intergenic
997174106 5:131756149-131756171 CAGTTTCAGTGGAGGCAGTGGGG + Intronic
997913692 5:137902390-137902412 CTGTCTCAGGGGTGGCAGAGCGG - Intronic
998374830 5:141683270-141683292 CTGCCTCAGGGGAAGAAGAGGGG + Intergenic
999392211 5:151201648-151201670 GTGCATCAGAGGAGGCTGAGCGG - Exonic
999537672 5:152535308-152535330 CTTTATAAGAGGAGGAAGAGAGG + Intergenic
1000922375 5:167153487-167153509 CTGTCTCAGGGGTGGAAGAGGGG + Intergenic
1000971388 5:167718438-167718460 TTGTCTCCAGGGAGGCAGAGAGG - Intronic
1001012446 5:168110560-168110582 CTGTCTCTCAGCAGGCAGAATGG - Intronic
1001179939 5:169510893-169510915 TTGTCACAGCTGAGGCAGAGGGG - Intergenic
1001242813 5:170082974-170082996 CTTACTTAGAGGAGACAGAGAGG + Exonic
1002066793 5:176655973-176655995 CCTTCTCAGAGGACGCAGATGGG - Intronic
1002107860 5:176889031-176889053 CTATGTCAGAGGGGGCAGTGGGG - Intronic
1002270702 5:178070103-178070125 CTTTCACAGATGAGGAAGAGAGG - Intergenic
1002608104 5:180395322-180395344 GTGTCCCAGGGGAGTCAGAGAGG + Intergenic
1003244170 6:4370177-4370199 CTGTAACAGAGCAGGCAGAGGGG + Intergenic
1003869658 6:10391398-10391420 CTGCCTGGGAGGAGGCAGCGCGG - Intergenic
1004222180 6:13756505-13756527 CTGTTTGAGAGGAGGAAGAGGGG - Intergenic
1004258132 6:14083872-14083894 GTGTGTCAGTGGAAGCAGAGTGG - Intergenic
1004551668 6:16653895-16653917 CTGTGGGAGAGGAGGCAAAGAGG + Intronic
1004606186 6:17196927-17196949 CTGTCTCACGGGTGGCAGAGTGG - Intergenic
1004608307 6:17214649-17214671 CTGGCTCAGAGGATCCAGAGAGG - Intergenic
1005021157 6:21420023-21420045 AGGTCTCAGAGGAGGTGGAGTGG - Intergenic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1007626463 6:43249183-43249205 ATTTCACAGAGGAGGAAGAGTGG + Intronic
1007745025 6:44038411-44038433 TTGCCTCAGGGGAGGCAAAGCGG + Intergenic
1012914656 6:105156580-105156602 CTGTCTCAGATGTGGCTGAGAGG - Intergenic
1015812260 6:137172591-137172613 ATGCCTGAAAGGAGGCAGAGCGG - Intronic
1016079172 6:139834786-139834808 CTGTCACAGAGGAGGCAGCCAGG - Intergenic
1016191911 6:141278877-141278899 CTTTCTCTGAGGAGAGAGAGAGG - Intergenic
1016203967 6:141450896-141450918 CTGTCCCAGGGGTGGCAGAGGGG + Intergenic
1016417075 6:143843859-143843881 CTTTCTCAGAGGAAACAGACAGG - Intronic
1017096126 6:150806744-150806766 CTGGAACACAGGAGGCAGAGAGG + Intronic
1017817568 6:158026819-158026841 CTGTGTCAGAAGAGGCAGGTGGG + Intronic
1018907418 6:168083643-168083665 CTGTCTCCCAAGGGGCAGAGGGG - Intergenic
1019054478 6:169213527-169213549 CAGACTCAGGGGAGCCAGAGGGG + Intergenic
1019262926 7:92150-92172 CACACTCAGAGGAGGCGGAGAGG + Intergenic
1019430961 7:999468-999490 CTAACTCTGAGGAGGGAGAGTGG + Intronic
1020398404 7:7745239-7745261 CTGTCTCAGGAGTGGCAGAGGGG + Intronic
1022012295 7:26319069-26319091 CTGTGTCAGTGGAGGAAGGGAGG + Intronic
1022150849 7:27604018-27604040 CTGTCTAAGTGGAGGAGGAGGGG - Intronic
1023301927 7:38782356-38782378 CTGTGTGAGAGAAAGCAGAGGGG - Intronic
1023651879 7:42379499-42379521 CTGGCACAGAGGCGGCAAAGAGG - Intergenic
1024028858 7:45438743-45438765 GTGGCTAAGAGGAGGCACAGAGG - Intergenic
1024173943 7:46819138-46819160 TGGTGTCAGAGAAGGCAGAGTGG + Intergenic
1024271555 7:47646201-47646223 CTGCTTTAGAGGACGCAGAGAGG - Intergenic
1024298174 7:47862967-47862989 TGGCCTGAGAGGAGGCAGAGAGG + Intronic
1024663269 7:51520085-51520107 CCTTCTGAGAGGAGGCTGAGAGG - Intergenic
1026893421 7:73996415-73996437 CTGTCTTGGAAGAGGAAGAGTGG - Intergenic
1026914313 7:74110865-74110887 TTTTCTCAGAGGAGGCAGATTGG + Intronic
1026960387 7:74404121-74404143 GTTTGTCAGTGGAGGCAGAGGGG + Exonic
1027174164 7:75892858-75892880 CTGGCTCAGAGGACGTGGAGAGG + Intergenic
1027705930 7:81533632-81533654 CTGTCTCAGAGGATGCCCAAAGG + Intergenic
1028164763 7:87525733-87525755 CTGTCTCAGGGGTGGCAGAGGGG + Intronic
1029223301 7:99007261-99007283 CTGTCTCAGAGCAGGAAGGCCGG + Intronic
1030006235 7:105123389-105123411 CTGACCCAGAGGAGAAAGAGCGG + Intronic
1030261561 7:107570427-107570449 TGGTGTCAGAGGAGGCATAGTGG - Intronic
1030724720 7:112913332-112913354 ATGACTCAGAGGAGCCAGGGAGG - Intronic
1031565487 7:123291925-123291947 TTGTTTCAGAGGTGACAGAGGGG + Intergenic
1032077511 7:128843085-128843107 GTGCCTCAGAGGAAGCAAAGGGG + Intronic
1032504576 7:132425586-132425608 CTGCCTTAGAAGAGGCAGACAGG + Intronic
1032841466 7:135717234-135717256 CTCACTCAGAGGAGTCAGAGTGG - Intronic
1033494999 7:141885201-141885223 CTGTCTCAGTGAAGACAGAAGGG + Intergenic
1033968780 7:147011637-147011659 TTGTCTCAGAGGAGAATGAGTGG - Intronic
1034860205 7:154588210-154588232 GTGTCCCAGAGGAGGGAGGGAGG + Intronic
1035160340 7:156945193-156945215 CTGTCTTGGAGGAGGAGGAGGGG - Intergenic
1035587168 8:785570-785592 CGGTCTCAGAGGGGCCTGAGGGG - Intergenic
1035587180 8:785604-785626 CGGTCTCAGAGGGGTCTGAGGGG - Intergenic
1035587193 8:785638-785660 CGGTCTCAGAGGGGCCTGAGGGG - Intergenic
1035587206 8:785672-785694 CGGTCTCAGAGGGGCCTGAGGGG - Intergenic
1035587218 8:785706-785728 CGGTCTCAGAGGGGCCTGAGGGG - Intergenic
1035587231 8:785740-785762 CGGTCTCAGAGGGGCCTGAGGGG - Intergenic
1035587244 8:785774-785796 CGGTCTCAGAGGGGCCTGAGGGG - Intergenic
1035587257 8:785808-785830 CGGTCTCAGAGGAGCCTGAGGGG - Intergenic
1035587268 8:785842-785864 CGGTCTCAGAGGGGCCTGAGGGG - Intergenic
1037498054 8:19459826-19459848 CTTTCTCTGAGAAGGTAGAGAGG + Intronic
1037805591 8:22056527-22056549 CTGTTTAGGAGGAGGCTGAGGGG + Intronic
1037883782 8:22585823-22585845 CTGAGTCAGAGGAGGAAGGGAGG - Intronic
1037903839 8:22703799-22703821 CAGTCTCTGAGGAGGCCGAGCGG - Intergenic
1040351840 8:46576864-46576886 CTGGCTATGAGGAAGCAGAGTGG - Intergenic
1042350777 8:67775203-67775225 GTGTCACAGAAGAGGAAGAGGGG - Intergenic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1045242097 8:100411554-100411576 CTGCCACAGAGGAGGAAGACAGG + Intergenic
1045544780 8:103118757-103118779 CTGGCTTAGAGGTGGCAGCGAGG + Intergenic
1045759610 8:105588764-105588786 CTGCCTGTGAGGAGGCAGTGTGG - Intronic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1047565354 8:126038607-126038629 GTGGCTCAGAGGAGGGAAAGAGG + Intergenic
1047704898 8:127488556-127488578 GAGTCTCAGCGGAGGCTGAGTGG - Intergenic
1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG + Intergenic
1048334235 8:133491101-133491123 GTGGCTCAGAGTAGGCAGTGTGG + Intronic
1048572064 8:135664651-135664673 CTGCCTCAGGAGAGGAAGAGGGG - Intergenic
1048701607 8:137097340-137097362 CTGTCTCAAATGAGTCAGAATGG + Intergenic
1048859811 8:138715981-138716003 CATTTTCAGAGGAGGCAGATGGG - Intronic
1049555514 8:143279444-143279466 CTGGGTCGGAGGAGGGAGAGGGG - Intergenic
1050219693 9:3373184-3373206 CTGTCTCGGAGTAGTCAGTGAGG - Intronic
1050694311 9:8261856-8261878 CTTTCTCTGTGGAGGCAGTGGGG + Intergenic
1051057634 9:13006697-13006719 CTCTCTCAGAGTAGGCACACAGG + Intergenic
1051167229 9:14276501-14276523 CTTTCTCAGAGAAGGCTGAAAGG + Intronic
1051963816 9:22801360-22801382 CTATCGCAGGGCAGGCAGAGGGG - Intergenic
1053034480 9:34812592-34812614 CTGTCTCTGAGGAAGCAGACTGG + Intergenic
1053421543 9:37983048-37983070 CAGTATGAGAGGAGACAGAGAGG + Intronic
1054338263 9:63828902-63828924 ATGTTTCAGAGGAAGCAGTGGGG + Intergenic
1054945677 9:70793618-70793640 CTGCCTTAGAGCAAGCAGAGTGG - Intronic
1054961978 9:70979408-70979430 CTGCATTAGAGGAGGCAGAGGGG + Intronic
1055270391 9:74551476-74551498 ATGTCCCAGACGAGACAGAGCGG + Intronic
1055777822 9:79784939-79784961 CTGTCTCCTTTGAGGCAGAGAGG + Intergenic
1056121213 9:83491167-83491189 GTAGCTAAGAGGAGGCAGAGTGG - Intronic
1056340601 9:85627657-85627679 CTGTCTCAGCAGGGGCAAAGGGG - Intronic
1056761634 9:89419487-89419509 CTGTCACACGGGAGGGAGAGGGG + Intronic
1057186372 9:93059377-93059399 CTGTCTCGGAGGAGGCTCAGAGG + Intronic
1057480377 9:95440607-95440629 CTGTCTCAGGATTGGCAGAGGGG + Intergenic
1057719807 9:97522973-97522995 CTAGCTCAGCGGAGGCAGTGTGG + Intronic
1058577689 9:106421327-106421349 ATGCCACAGAGGAGGGAGAGTGG - Intergenic
1059384161 9:113950970-113950992 ATGTCTCTGAGGAGGAGGAGTGG + Intronic
1059861321 9:118466244-118466266 CTGTATCAGAGCAGGCACATTGG - Intergenic
1060030029 9:120206408-120206430 CAGTCTCAGTGGTGGCAGATGGG + Intergenic
1060104106 9:120862831-120862853 CTGGGTCCAAGGAGGCAGAGAGG - Intronic
1060863506 9:126975874-126975896 CTGGCTGAGAGGTGGGAGAGAGG - Intronic
1060869845 9:127030755-127030777 AGGTCTCTGAGAAGGCAGAGGGG + Intronic
1061451432 9:130668995-130669017 CCTTCTCAGAGGAGACAGACAGG + Intronic
1061502571 9:131012506-131012528 ATGTCTTTGAGGAGGCAGGGCGG - Intronic
1061807855 9:133146513-133146535 GTGTCTGAGAGGAGGCAGTCAGG - Intronic
1061918607 9:133769997-133770019 CTCTCACAGAGGAGGCCCAGGGG + Intronic
1185715397 X:2337986-2338008 TTGTCTCAGCTGAGGCACAGCGG - Intronic
1185797267 X:2977147-2977169 CTGTCTCAGGGATGGCAGAGTGG - Intergenic
1186895344 X:13999657-13999679 CTGTCACAGAGGAGACTAAGGGG - Intergenic
1187181568 X:16947355-16947377 CTGTCTCAGGGAAGGAAGATGGG - Intronic
1187308052 X:18115054-18115076 CTGGACCTGAGGAGGCAGAGGGG - Intergenic
1188270939 X:28139681-28139703 TTGTGTCAGAGGAGGCCTAGTGG - Intergenic
1189301914 X:39958333-39958355 CTTCCTGAGAGCAGGCAGAGTGG + Intergenic
1190248557 X:48706269-48706291 TTACCTCAGAGGAGGCAGAGCGG + Exonic
1190412219 X:50148069-50148091 CTTGCTCAGGGGAGACAGAGAGG + Intergenic
1192240815 X:69326540-69326562 CTGTCTCCCAGGAGGGAGAATGG - Intergenic
1195308008 X:103604569-103604591 CTGTCTCTGGGGACTCAGAGAGG + Intergenic
1195485068 X:105395287-105395309 CAGCCTCAGAGGGGGCAGACTGG - Intronic
1196894410 X:120320861-120320883 CTGGGTGAGAGGAGGCAGACAGG - Intergenic
1197765273 X:130056037-130056059 CAGTCTCAGAGGAGCCTGGGGGG - Exonic
1198641252 X:138758570-138758592 CTGTGTGAGAGGAGCCAGATTGG - Intronic
1199399285 X:147377453-147377475 CTCTCTCGGAGGAGACAGAGTGG - Intergenic
1199803401 X:151273295-151273317 CTGTCCCAGTGGAGGGAGACAGG + Intergenic