ID: 982073849

View in Genome Browser
Species Human (GRCh38)
Location 4:151719380-151719402
Sequence CAGCTCTGAGAACTTGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 208}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982073841_982073849 -2 Left 982073841 4:151719359-151719381 CCCCCCACAGCAGGGCTGGCCCA 0: 1
1: 0
2: 1
3: 41
4: 409
Right 982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG 0: 1
1: 0
2: 0
3: 35
4: 208
982073843_982073849 -4 Left 982073843 4:151719361-151719383 CCCCACAGCAGGGCTGGCCCAGC 0: 1
1: 0
2: 9
3: 56
4: 448
Right 982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG 0: 1
1: 0
2: 0
3: 35
4: 208
982073844_982073849 -5 Left 982073844 4:151719362-151719384 CCCACAGCAGGGCTGGCCCAGCT 0: 1
1: 0
2: 1
3: 43
4: 435
Right 982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG 0: 1
1: 0
2: 0
3: 35
4: 208
982073832_982073849 17 Left 982073832 4:151719340-151719362 CCCCTTTCCCTTGCTCCGACCCC 0: 1
1: 1
2: 0
3: 32
4: 491
Right 982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG 0: 1
1: 0
2: 0
3: 35
4: 208
982073842_982073849 -3 Left 982073842 4:151719360-151719382 CCCCCACAGCAGGGCTGGCCCAG 0: 1
1: 0
2: 3
3: 87
4: 474
Right 982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG 0: 1
1: 0
2: 0
3: 35
4: 208
982073835_982073849 10 Left 982073835 4:151719347-151719369 CCCTTGCTCCGACCCCCCACAGC 0: 1
1: 0
2: 3
3: 16
4: 203
Right 982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG 0: 1
1: 0
2: 0
3: 35
4: 208
982073836_982073849 9 Left 982073836 4:151719348-151719370 CCTTGCTCCGACCCCCCACAGCA 0: 1
1: 0
2: 4
3: 17
4: 317
Right 982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG 0: 1
1: 0
2: 0
3: 35
4: 208
982073833_982073849 16 Left 982073833 4:151719341-151719363 CCCTTTCCCTTGCTCCGACCCCC 0: 1
1: 0
2: 2
3: 36
4: 393
Right 982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG 0: 1
1: 0
2: 0
3: 35
4: 208
982073845_982073849 -6 Left 982073845 4:151719363-151719385 CCACAGCAGGGCTGGCCCAGCTC 0: 1
1: 1
2: 3
3: 74
4: 567
Right 982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG 0: 1
1: 0
2: 0
3: 35
4: 208
982073834_982073849 15 Left 982073834 4:151719342-151719364 CCTTTCCCTTGCTCCGACCCCCC 0: 1
1: 0
2: 6
3: 79
4: 755
Right 982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG 0: 1
1: 0
2: 0
3: 35
4: 208
982073839_982073849 2 Left 982073839 4:151719355-151719377 CCGACCCCCCACAGCAGGGCTGG 0: 1
1: 1
2: 3
3: 68
4: 472
Right 982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG 0: 1
1: 0
2: 0
3: 35
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982073849 Original CRISPR CAGCTCTGAGAACTTGCAGT GGG Intronic
900892290 1:5458271-5458293 CAGCTCTGATAGCTTGAAGCTGG - Intergenic
901373666 1:8821976-8821998 GAGCTCGGAGAACTGGCAGTGGG - Intergenic
901617854 1:10556102-10556124 CAGCGCTGAGCACTGGCAGACGG - Intronic
901632286 1:10653732-10653754 CAGCCCCGAGATCTTGCTGTTGG + Exonic
903654654 1:24941980-24942002 CAGGTCTGAGGACATTCAGTGGG - Intronic
905604246 1:39283096-39283118 CAGCTCTGGGAACTTTCAGGAGG + Intronic
907247665 1:53118229-53118251 CTTTTCTGAGAACTTGCAGCTGG + Intronic
908051465 1:60236112-60236134 CAGTTCTGAAAACTTTAAGTGGG + Intergenic
909108842 1:71448661-71448683 AAGCTCTGAGAACGAGCAGTAGG + Intronic
909804296 1:79855908-79855930 CAGTTCTGAGGACATTCAGTTGG - Intergenic
910621398 1:89259678-89259700 AAGTTCTGGGAACTTGCGGTGGG - Intronic
911332613 1:96542478-96542500 CAGCCCTGAGAACGGGCAGTGGG - Intergenic
915114188 1:153585224-153585246 CAGCTCTGTGGATTTGCAGTGGG - Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
918230589 1:182527657-182527679 CAGCTGTGAGAAATTGCAATGGG - Exonic
919948787 1:202342941-202342963 CAGCTCTGAGAAGTTAAGGTTGG - Intergenic
921162115 1:212480420-212480442 CAGCTCAGAGAACTTCCGGTTGG + Intergenic
924647162 1:245888851-245888873 CTGCTCTGAGAAGTTGCTGTTGG - Intronic
1064680814 10:17809356-17809378 CAGCTCTGGGAACTTGGATTAGG + Exonic
1065340072 10:24696306-24696328 AAGCTCTGAGAATCTGCAGGGGG + Intronic
1066369337 10:34806857-34806879 CAGCTCAGGGAACTGGCAGTGGG + Intronic
1067021398 10:42802062-42802084 CAACTCTAAGAAATGGCAGTAGG - Intronic
1068014517 10:51499179-51499201 GAGCTCTGAGTACATGCAGAAGG + Intronic
1069634479 10:69917102-69917124 CAGCTATGTGAACTTGCAGGAGG - Intronic
1071091778 10:81927349-81927371 CACCTCTGAGAACTTAAAGGTGG + Intronic
1074701764 10:116098555-116098577 CAGCTGCCTGAACTTGCAGTTGG - Intronic
1075635112 10:124025445-124025467 CTGCTCAGAGAACTGGCAGTGGG + Intronic
1077416166 11:2425284-2425306 CCGCTCTGAGAGCTTCCAGGGGG - Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1084826612 11:71736626-71736648 CAGCTCTGAGAAGCTCTAGTAGG - Intergenic
1085274616 11:75290301-75290323 GAGCTCAGAAAACTTGCACTTGG - Intronic
1087156290 11:94908097-94908119 CTGTTCTGGGAACTTGAAGTTGG - Intergenic
1090307224 11:125702050-125702072 CAGGTCTGAGAACTTGCCCCAGG - Intergenic
1090920674 11:131203624-131203646 CAGCTCTGAGAAGTTGCCATGGG - Intergenic
1091269984 11:134301304-134301326 CAGCTCAGAGATATAGCAGTGGG - Intronic
1091688701 12:2581493-2581515 CTCCTCTGAGAACCTGCAGTGGG + Intronic
1092477387 12:8830763-8830785 CAGCTCTGAGAACACGGAGATGG - Intronic
1092680988 12:10981067-10981089 CAGCCCTGAGAACTGGCTGAGGG - Intronic
1093818143 12:23575728-23575750 CAGCTCTGAGAATAAACAGTGGG - Exonic
1095536397 12:43253398-43253420 AAGCTCTAAGAACTTCCACTTGG + Intergenic
1096540836 12:52306124-52306146 CAGCTCGGCCAACTTGCAGCGGG - Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096602647 12:52741446-52741468 CAGCTCTGACGATTTGCATTTGG - Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1096977287 12:55706891-55706913 CAGGTCTGCCAACCTGCAGTAGG - Intronic
1099947679 12:89263500-89263522 CATCTCTGAGAACTGGGAATTGG - Intergenic
1100615522 12:96228706-96228728 CTTCTCTGAGCACCTGCAGTTGG + Intronic
1101880251 12:108621487-108621509 CAGCTATGGGATTTTGCAGTGGG - Intergenic
1102740040 12:115199033-115199055 CAGGTTTGAGAACTGGCAGAAGG + Intergenic
1106285462 13:28314652-28314674 CAGTTCTGAGAAGCTGCACTTGG + Intronic
1106521656 13:30503724-30503746 GAGCTCAAAGAACTTGCAGCAGG + Intronic
1106558474 13:30829713-30829735 CTGCTCAGAGAACTCACAGTGGG - Intergenic
1107103081 13:36614834-36614856 CAGCTCAGTGAACATGCAGCTGG + Intergenic
1108760539 13:53557932-53557954 CAGCGCTGAGACCTAGCAGGTGG + Intergenic
1109103849 13:58223191-58223213 CATCTCCCAGAACTTGCAGCAGG + Intergenic
1110315646 13:74102739-74102761 CAGGTCTGAGATCCTGCTGTAGG - Intronic
1111453721 13:88452671-88452693 CACCTGTGAGAACCTTCAGTGGG + Intergenic
1111740860 13:92204565-92204587 GAACTCTCAAAACTTGCAGTTGG - Intronic
1111889207 13:94060513-94060535 AAGGCCTGAGAAATTGCAGTGGG + Intronic
1115765349 14:36617722-36617744 CAGCCTTGAGAGCCTGCAGTGGG + Intergenic
1118073051 14:62267308-62267330 CAGCACTGTGAACTGTCAGTGGG + Intergenic
1118532254 14:66719098-66719120 CAGGGCTGAGAACTTGCACCAGG + Intronic
1119329157 14:73781130-73781152 CAGCTGTGGGAACTTGGAGAAGG + Intronic
1119376267 14:74196143-74196165 CAGCTCTGTGTACTTGGATTAGG + Intronic
1120310779 14:82825140-82825162 CAGCTCTGAAACCATGCAGAAGG - Intergenic
1120491641 14:85185492-85185514 CAGCTCTGAGATGTGGCAATTGG + Intergenic
1122144134 14:99679122-99679144 CAGCTCTGGGACCCTGCTGTGGG + Exonic
1123137814 14:106045716-106045738 CACCACTGAGAACTTCCACTTGG + Intergenic
1127716497 15:61654025-61654047 CAGCTGTGAGAACTGCCAGTGGG - Intergenic
1128244816 15:66125973-66125995 CGGGTCAGAGAACTTGGAGTTGG - Intronic
1128814541 15:70598036-70598058 CAGCTCTAAGCACTGGCTGTAGG - Intergenic
1129297304 15:74606640-74606662 CAAGTCTGAGGACTTGCAGTGGG - Intronic
1130340438 15:82996567-82996589 CAGGACGCAGAACTTGCAGTAGG + Intronic
1133191469 16:4136614-4136636 CAGCTCCTAGAACTTCCGGTGGG - Intergenic
1133425823 16:5688554-5688576 CAGCTCTGAGATACTGCAGTTGG + Intergenic
1135486987 16:22874378-22874400 CAAATCTGAGAACTTGCAGATGG - Intronic
1137008871 16:35303815-35303837 CTGCTCTGAGAACTTACTGATGG + Intergenic
1137767773 16:50991251-50991273 CACCTCTGGGACCTTGCGGTGGG + Intergenic
1139171535 16:64635891-64635913 CAGCTCTGGCATTTTGCAGTAGG + Intergenic
1139950894 16:70669088-70669110 CATCTTTGTGACCTTGCAGTAGG + Intronic
1140148590 16:72337952-72337974 CAGACCTGGGAACTTCCAGTGGG - Intergenic
1141844227 16:86596173-86596195 CTGCTCTGAGAACCAGCAGAAGG + Intergenic
1142127722 16:88418488-88418510 CAGCTCTCAGCAATTTCAGTGGG + Intergenic
1145820126 17:27826083-27826105 CAGCTATGAGAATTTTCAGAAGG + Intronic
1147122265 17:38342836-38342858 CAGCTGTGTGTACTTACAGTCGG - Intronic
1147420954 17:40321972-40321994 CAGCTCTGAAAACTTGAAGGAGG - Intronic
1148778068 17:50106854-50106876 CACCTCAGAGACGTTGCAGTTGG - Exonic
1153844158 18:9033401-9033423 CAGCTCTCAGGAATTGGAGTTGG - Intergenic
1153944017 18:10003121-10003143 CAGCTGTGGGATTTTGCAGTGGG - Intergenic
1155545382 18:26909207-26909229 CAGCTCAGAGAATTGTCAGTGGG - Exonic
1157387973 18:47275809-47275831 CTGCTCTGAGCACTTGCAGGAGG + Intergenic
1158242374 18:55391505-55391527 CATCTCTGTGAACCAGCAGTGGG + Intronic
1158419545 18:57280574-57280596 CAGCTCAGAAAACTAGCAGTTGG + Intergenic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1162084805 19:8242071-8242093 CAGCTCAGAGACCTTGCACCTGG - Intronic
1165124862 19:33586792-33586814 CACCTCTGAACACTTGCACTGGG - Intergenic
1165675437 19:37718893-37718915 CGGCTGTGAGATTTTGCAGTGGG - Intronic
1166705896 19:44907840-44907862 CAGCGCTGGGAACTGGCACTGGG + Exonic
1167168714 19:47817040-47817062 CAGCTCTGAGAACTAGCCTTGGG - Intronic
1167461004 19:49624766-49624788 CAGATCTGAGACCTGGCTGTTGG + Intronic
925462011 2:4071636-4071658 CAGCTCTGAGCACTTGCATCAGG - Intergenic
925614786 2:5734938-5734960 CTGCTCTAAGAGCTTGCAGAGGG - Intergenic
927082152 2:19641122-19641144 CAGCTCTGAAAACTTTAGGTAGG + Intergenic
927843400 2:26459048-26459070 GAGCTCTGAGCACCTGCAGTTGG + Intronic
929026066 2:37603635-37603657 GAGCCCTCAGAACTTGGAGTTGG - Intergenic
932482907 2:72059191-72059213 AATCTCTAAGAACTTGCTGTAGG + Intergenic
933628481 2:84629745-84629767 CAGCTCTGGTTACTTTCAGTAGG - Intronic
935278045 2:101492637-101492659 CAGCTCTCAGCAGTTGGAGTTGG - Intergenic
936666914 2:114607630-114607652 CAGCTCTGGGAATATGCAGAAGG + Intronic
937828981 2:126399586-126399608 CAGAGCTGAGAACTTGCCCTAGG + Intergenic
937906119 2:127053706-127053728 CAGCTGGGAGAACTCTCAGTAGG - Intronic
939806112 2:146777421-146777443 CAGCTCTAACAGCTTGCATTTGG - Intergenic
939890238 2:147727663-147727685 GAGATCTGAGAACTGGCAGACGG + Intergenic
940217484 2:151315597-151315619 CAGGGCTGAGAACTTGCTGCAGG - Intergenic
941402243 2:165045093-165045115 CAGGGCTGAGAACTTGCCCTAGG + Intergenic
944354994 2:198777205-198777227 CAGCTCCCAGAACTTCCAGAAGG + Intergenic
946061882 2:216949708-216949730 CAGTTGTGGGAACTTGCAGCGGG - Intergenic
948077773 2:235179785-235179807 AGGCTCTGAGAAGGTGCAGTGGG + Intergenic
1169084425 20:2817874-2817896 GAGCTCTAAGAACTTTCTGTAGG + Intronic
1170137585 20:13091790-13091812 TAGCTCTGAGAAGTTGCAGATGG - Intronic
1170495077 20:16915972-16915994 CAGCTCAGAGGACCTGCAGTGGG - Intergenic
1170732398 20:18986392-18986414 AAGCTCTGTGACCTTGCAGAAGG - Intergenic
1179573048 21:42289348-42289370 CAGCCCTTAAAACTTCCAGTTGG + Intronic
1180149601 21:45940885-45940907 CAGCTCAGGGCTCTTGCAGTAGG - Intronic
1182087723 22:27573209-27573231 CTGCTCTCAGAACCTGAAGTCGG + Intergenic
1182658189 22:31906232-31906254 CTGCCCTGAGAACTTGCGCTTGG - Exonic
1182800309 22:33026701-33026723 TAGCTCTGGGAACTAGGAGTTGG - Intronic
950176754 3:10880461-10880483 CAGCTATGAGAAATTTAAGTGGG + Intronic
951183750 3:19688550-19688572 CAGGTCTGAGAACTTGCCCCAGG - Intergenic
951292388 3:20889106-20889128 CAGCAATGAGATTTTGCAGTGGG + Intergenic
951294470 3:20917399-20917421 CAGGGCTGAGAACTTGCCCTAGG - Intergenic
952732437 3:36653109-36653131 CAGGGCTGAGAACTTGCTGCAGG - Intergenic
953185253 3:40631570-40631592 CAGGGCTGAGAACTTGCCTTAGG - Intergenic
953607241 3:44419953-44419975 CAGCTCAGAGAACTCTCAGAAGG + Intergenic
954199475 3:49015650-49015672 CAGCTCTCAGAAGCTGCAGGCGG + Exonic
954755239 3:52835658-52835680 CCCCTCTCTGAACTTGCAGTTGG - Exonic
955986966 3:64583718-64583740 CAGTTTTGAGAACTTGCTGAAGG - Intronic
956111402 3:65873292-65873314 CAGGCCTGAGAGCTTGCCGTGGG - Intronic
956700352 3:71953322-71953344 TAGCTCAGATAACTTGCAATAGG - Intergenic
958149356 3:89670560-89670582 CATGTCAGAGAACTTGCAGAAGG + Intergenic
958879975 3:99658600-99658622 CAGCACTGAGTACCTGCACTTGG - Intronic
959952981 3:112201957-112201979 CAGATCTTAGAGCTTGCATTGGG + Intronic
960040282 3:113143501-113143523 CATCTCTGAGAACTTTCTCTGGG + Intergenic
960131997 3:114066794-114066816 CAGCGGTGAGAACTTGCATGGGG + Intronic
960516502 3:118608080-118608102 CAGGGCTGAGAACTTGCCCTAGG - Intergenic
963340727 3:144029318-144029340 CAGCTCTCAGACCCTGCTGTTGG - Intronic
964392119 3:156208546-156208568 CATCTCTGACAACTTGGAGGGGG + Intronic
966315741 3:178643827-178643849 CAGCTCTGAGAACTGGGAAGTGG - Intronic
967233813 3:187366052-187366074 AAGCTCTAAGAACTTGTAATTGG - Intergenic
969838665 4:9864343-9864365 CAGCTCTGGGCACTTGCAGGAGG - Intronic
976479673 4:85525960-85525982 CAGCTCTGAGAACAGGCCCTTGG - Intronic
977318157 4:95477450-95477472 CAGCTCTGTGAAACTGAAGTTGG + Intronic
977514661 4:98006433-98006455 CAGATCTGAGAACATGCATAGGG - Intronic
977978535 4:103295821-103295843 TAGCTCAGAGGACTTGCAGAAGG - Intergenic
979584886 4:122404065-122404087 CAGCGCTGAGATCTTGCACGAGG + Intronic
981614441 4:146632579-146632601 CAGCTCTGAGGAGTGGCAGGAGG + Intergenic
982073849 4:151719380-151719402 CAGCTCTGAGAACTTGCAGTGGG + Intronic
982964532 4:161887987-161888009 CAGCACTGACAACTTCCAGTTGG - Intronic
985212300 4:187608177-187608199 CTGCTCTAACACCTTGCAGTGGG + Intergenic
985720433 5:1485994-1486016 CTGCTCTGAGAGCTTGGAGCTGG + Intronic
985861586 5:2475784-2475806 CAAATCTGAAAACTTGAAGTCGG - Intergenic
985998759 5:3613678-3613700 CGGTTCTCAGAACTTGCAGTTGG + Intergenic
986102871 5:4630292-4630314 CCGCTCTGAGAACTGGCTGGTGG + Intergenic
986224620 5:5801286-5801308 CAGCTCTAAGCACTGGCACTTGG + Intergenic
986292929 5:6414858-6414880 CAGCTCTGAGAGCTGTCACTGGG + Intergenic
990571216 5:57080907-57080929 AAGCTCCGAGAACATGCAGGAGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995427873 5:112044793-112044815 CAGCTCTGATGGCTTCCAGTTGG + Intergenic
996277924 5:121690753-121690775 CAGCTCTAAGGATTTGCAGAGGG + Intergenic
997481869 5:134191574-134191596 CAGCTCTGAGGAGGAGCAGTGGG + Intronic
998546071 5:143028998-143029020 CAGCTCTCAGAAGCTTCAGTGGG - Intronic
999990638 5:157046901-157046923 CAGCTCTTAATACTTGCATTGGG + Intronic
1001481369 5:172091437-172091459 CAGAGCTGAGAACTTCCAGAGGG - Intronic
1002932615 6:1644782-1644804 AAGCTGTCAGAGCTTGCAGTGGG - Intronic
1004716350 6:18219936-18219958 CATCTCTGAGGAGTTGCAGCCGG + Intronic
1005753742 6:28907034-28907056 CAGCTCTGAGACATTTCAGGAGG + Intronic
1008140357 6:47824655-47824677 CACATCTGGGAACCTGCAGTTGG - Exonic
1008407573 6:51136179-51136201 CAGCTTTGAGGAGCTGCAGTGGG + Intergenic
1010552306 6:77237760-77237782 CAGCTCTGATAGCTTCCATTTGG - Intergenic
1010567300 6:77431690-77431712 CATCTTTCAGAACCTGCAGTGGG + Intergenic
1010870470 6:81031027-81031049 CATCTCTAAGGACTTGCTGTGGG + Intergenic
1011058135 6:83229286-83229308 CAGGTCTCAGAATTTGGAGTTGG + Intronic
1012910043 6:105108062-105108084 CTGCTCTGAGAACGTGCTCTTGG - Intronic
1013625644 6:111934702-111934724 CAGCTTTGCCAACCTGCAGTGGG + Intergenic
1014468195 6:121782424-121782446 CATTTCTGAGAACTAGCAGATGG - Intergenic
1018132645 6:160747414-160747436 CACCTCTGAGAAACTGCAGCAGG - Intronic
1019269952 7:141419-141441 CAGCTGTGCAGACTTGCAGTGGG - Intergenic
1021787322 7:24164872-24164894 CAGCTCTAGGAACTGGCACTGGG + Intergenic
1023887387 7:44368738-44368760 CCACTCTGAGCACCTGCAGTTGG + Intergenic
1023993191 7:45142659-45142681 CTGCTCTGAGAACATGCACTGGG - Intergenic
1024338550 7:48234401-48234423 TTGCTCTGGGAACTAGCAGTGGG + Intronic
1024577354 7:50775421-50775443 CAGCTCTCACAGGTTGCAGTTGG + Intronic
1026371612 7:69705320-69705342 CAGCTCTTAGTACTAGCACTAGG - Intronic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1029531324 7:101127227-101127249 CACCTCTGAGAACTTCAGGTAGG + Exonic
1030069147 7:105683894-105683916 CAGATCTTAGACCTTGAAGTTGG + Intronic
1033151226 7:138916582-138916604 CTGTTCTGAGAACTCGCAGGAGG + Intronic
1033561513 7:142536482-142536504 AAGATGTGAGAACTTCCAGTGGG - Intergenic
1035259455 7:157652448-157652470 CAGCTCTGACACCTTGCTGATGG + Intronic
1037647329 8:20804465-20804487 GAGCTCTCAGGACTTGCCGTAGG + Intergenic
1038063308 8:23936322-23936344 CAGCTCTGAGAACTTTGCGCGGG + Intergenic
1038795164 8:30703292-30703314 AAGTTCTGATAAGTTGCAGTAGG - Intronic
1039150239 8:34496637-34496659 GAGCTCTGAGATCCTCCAGTGGG + Intergenic
1039833875 8:41239984-41240006 AAGCTCTGAGAATTTCAAGTAGG - Intergenic
1040967060 8:53093252-53093274 CAGGACTGAGAACTTGCCCTGGG + Intergenic
1041135701 8:54756272-54756294 GATCTTTGAGAAGTTGCAGTAGG + Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042679318 8:71363594-71363616 CTGGTCTGAGAAAGTGCAGTAGG - Intergenic
1042788814 8:72580688-72580710 AAGGTAAGAGAACTTGCAGTAGG - Intronic
1043613564 8:82095698-82095720 CTTCACTGAGAACTGGCAGTGGG + Intergenic
1044073385 8:87789572-87789594 CAGCTCTGAGAATAAACAGTGGG - Intergenic
1044617647 8:94158575-94158597 CAGTTTTCAGAGCTTGCAGTGGG - Intronic
1045315145 8:101037483-101037505 CTGCTATGAGATCTTACAGTTGG + Intergenic
1045694498 8:104793307-104793329 CAGCCCTGAAAGCTTGCAGGTGG + Intronic
1050057528 9:1671501-1671523 CAGCTCTCAAAACGTGCACTGGG + Intergenic
1050803554 9:9645189-9645211 CCGCTCTGGGAACTTGCAATGGG - Intronic
1050903420 9:10974528-10974550 CAGCGCTGAGAACTTGCCGGAGG - Intergenic
1051025381 9:12604258-12604280 CACCTCTATGAACTTGCACTGGG - Intergenic
1052123483 9:24747684-24747706 CATCTCTGATAACTTGAACTTGG + Intergenic
1053581846 9:39413004-39413026 AAGCTCTGAGAACTTAAAGCTGG + Intergenic
1053846265 9:42240340-42240362 AAGCTCTGAGAACTTAAAGCTGG + Intergenic
1054103425 9:60971736-60971758 AAGCTCTGAGAACTTAAAGCTGG + Intergenic
1054582929 9:66935101-66935123 AAGCTCTGAGAACTTAAAGCTGG - Intergenic
1057253420 9:93522917-93522939 CAGCACTGAGACCTAGCTGTTGG + Intronic
1057412308 9:94827620-94827642 CAGCCCTGAAAACATGCGGTAGG - Intronic
1061924865 9:133801032-133801054 CAGCTCTGAGCTCCTGCAATGGG + Intronic
1186207645 X:7216975-7216997 CAGCAATGGGGACTTGCAGTGGG + Intergenic
1187590516 X:20712534-20712556 CATCTCTGAGGCCTTGCAGATGG - Intergenic
1189539525 X:41971565-41971587 CAGGTCTGAGAACTTGCCCCAGG - Intergenic
1189704539 X:43746938-43746960 CAACTTTGAGAATTTGCAGTCGG - Intergenic
1189717861 X:43883375-43883397 CACCTCTGAGAACTAAAAGTGGG + Intergenic
1190615178 X:52222753-52222775 GAGATCTGAGAACTGGCAGACGG + Intergenic
1191183331 X:57585170-57585192 AAGCTATGAGACCTTTCAGTGGG - Intergenic
1191214044 X:57917224-57917246 AAGCTATGAGACCTTTCAGTGGG + Intergenic
1191674504 X:63780311-63780333 CAGCTGTTAAACCTTGCAGTTGG + Intronic
1192611147 X:72568514-72568536 CAGATCTGAGCACTGCCAGTAGG + Intronic
1194165325 X:90507920-90507942 CAGGGCTGAGAACTTGCTCTAGG - Intergenic
1194510081 X:94783206-94783228 CAGGTCTGAGAACTTGCCCTAGG - Intergenic
1194532784 X:95071809-95071831 CAGTGCTGAGAACTTGCCTTAGG - Intergenic
1194946783 X:100078183-100078205 CACCTCTGATAACATCCAGTGGG - Intergenic
1195990757 X:110679828-110679850 AAGCACTGAGAGCCTGCAGTGGG + Intronic
1198141343 X:133807022-133807044 ATGATCTGAGAACATGCAGTAGG - Intronic
1200511594 Y:4085730-4085752 CAGGGCTGAGAACTTGCTCTAGG - Intergenic
1201579471 Y:15495646-15495668 CAGCAATGGGGACTTGCAGTGGG + Intergenic