ID: 982074561

View in Genome Browser
Species Human (GRCh38)
Location 4:151725631-151725653
Sequence TTGCTTAGCAAACCCTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982074561 Original CRISPR TTGCTTAGCAAACCCTTTCC TGG (reversed) Intronic
905533166 1:38698249-38698271 TTTCTAAGCCAAACCTTTCCAGG + Intergenic
905726116 1:40253346-40253368 TTCCTTTGCAAAGCCTTTCCTGG - Intergenic
905918541 1:41702982-41703004 TTGACTAACAAACCCTTGCCCGG + Intronic
906766127 1:48436061-48436083 TTGATGAGCCAACCCTTTCCTGG + Intronic
907804943 1:57809524-57809546 TTGCTTAGCAAAACTTTTTAAGG - Intronic
908947028 1:69510800-69510822 TTGTTTAGTCACCCCTTTCCTGG - Intergenic
918310020 1:183279162-183279184 TTGCTTCTCAAGCCCTTTGCTGG - Intronic
919319946 1:196023277-196023299 TTGCTTTGCATTCTCTTTCCTGG + Intergenic
921125804 1:212177024-212177046 TTGCCTGGCAAACCCTCTCAGGG - Intergenic
921146629 1:212364316-212364338 ATGCCTAACAAACCCTTCCCTGG + Intronic
921461566 1:215433114-215433136 TGGCTTAGGTACCCCTTTCCAGG + Intergenic
924021824 1:239791451-239791473 CTGCTTAGCAGATCCTTTCATGG - Intronic
924152127 1:241140245-241140267 TGGCCAAGCAGACCCTTTCCAGG + Intronic
1064325182 10:14343766-14343788 TTGCCTGGAAAACCCTTCCCTGG + Intronic
1064943648 10:20762969-20762991 CTCCTTAGCAAAGCCTTCCCTGG - Intergenic
1067758885 10:49027943-49027965 TGGCCTAGCAAACCCACTCCTGG - Intronic
1071674433 10:87641569-87641591 TTGCTTAGCAAACTCTTTATTGG - Intergenic
1072031846 10:91529023-91529045 TTTCTTATCATACCCTTTGCTGG + Intergenic
1072696476 10:97607436-97607458 TTGCTAGGCAACCCCTTTTCTGG + Intronic
1073426729 10:103459562-103459584 GTGGATGGCAAACCCTTTCCTGG + Intergenic
1075448023 10:122527147-122527169 CTGCTTAACACACACTTTCCAGG - Intergenic
1075532876 10:123244793-123244815 TTGATAAGCATACACTTTCCTGG - Intergenic
1075831592 10:125416635-125416657 TTTCTTAGCACACTCTCTCCAGG - Intergenic
1077449622 11:2630918-2630940 TTTCTGAGCAAAAACTTTCCAGG - Intronic
1080679264 11:34458814-34458836 TTGCTTTGCAGTCCTTTTCCCGG - Intronic
1085757272 11:79212357-79212379 CTGATTTGCAACCCCTTTCCAGG + Intronic
1085970387 11:81582713-81582735 TTTCTTAGAAAAGTCTTTCCTGG - Intergenic
1088037811 11:105338665-105338687 TGGCTTAGCAATCCCATTACTGG + Intergenic
1089305258 11:117522430-117522452 TGGCTTAGCAAGCCATTTACAGG + Intronic
1089652328 11:119922387-119922409 TTGCTTAGCAAAACCTCGACGGG + Intergenic
1093814306 12:23526217-23526239 TTGCTTATCAAATCCTCTGCTGG - Intergenic
1096834283 12:54339061-54339083 TTGCTTTGCTACCTCTTTCCTGG - Intronic
1100639695 12:96470757-96470779 TTGCTAAGCTACCCCTTTCCAGG + Intergenic
1101207404 12:102502313-102502335 TTGATTATCAAATCCTTCCCAGG - Intergenic
1102941708 12:116948156-116948178 TAGTTTAGCAAATCATTTCCAGG - Intronic
1103022548 12:117547668-117547690 TTGCTAAGCTGTCCCTTTCCTGG + Intronic
1104414870 12:128589675-128589697 TTGCTCAGCATTCACTTTCCAGG + Intronic
1108709162 13:53016151-53016173 TTGTCTAGCAGAGCCTTTCCGGG + Intergenic
1110161539 13:72384331-72384353 TTGCTCAGCATACGCCTTCCTGG + Intergenic
1113063400 13:106349477-106349499 GGGTCTAGCAAACCCTTTCCAGG - Intergenic
1116862511 14:50005966-50005988 TTGTTCAGCCAACTCTTTCCGGG + Exonic
1122087912 14:99319938-99319960 TTGCTAAGAAAACACTTCCCAGG - Intergenic
1124659191 15:31531580-31531602 TTGCTAAGCTACCCCTTTCCTGG - Intronic
1125726123 15:41868990-41869012 TTGCCTGGCAAAGCCTTCCCTGG + Intronic
1126198102 15:45954259-45954281 TGGCCTAGCAAACCCATTACTGG - Intergenic
1126875189 15:53033830-53033852 TTCCTGAGCAAACAGTTTCCTGG + Intergenic
1128217092 15:65942066-65942088 TTGGTTTGCAAACCCTCTCTAGG - Intronic
1129144994 15:73639044-73639066 CTCCTTATCAAAGCCTTTCCTGG + Intergenic
1129229585 15:74189308-74189330 TAGCACAGAAAACCCTTTCCTGG - Intronic
1137434088 16:48441417-48441439 CTGCATAGCAACACCTTTCCTGG + Intronic
1140999050 16:80290579-80290601 TGGCTTAGGCAACCCCTTCCTGG - Intergenic
1142547988 17:718810-718832 TTCCTCAGAAAAGCCTTTCCTGG - Intronic
1143569438 17:7746002-7746024 CTACTTAAAAAACCCTTTCCTGG + Intronic
1144999107 17:19291027-19291049 TCACTTGGCAAACCCTTGCCGGG - Intronic
1146603068 17:34235298-34235320 TAGCTGAGCAAAACCCTTCCAGG - Intergenic
1149148910 17:53535378-53535400 TTGCTTAACAAACACTTTTTTGG - Intergenic
1151138985 17:71973868-71973890 CTGCTTAGAAAAGCCTTCCCTGG + Intergenic
1151469126 17:74306992-74307014 CTCCTTAGCAAACCCATTCCTGG - Intronic
1152980625 18:272888-272910 TTGCAAAGCCAACCCTTTCTTGG - Intergenic
1156360059 18:36377187-36377209 TTTCTTCCCAGACCCTTTCCAGG + Intronic
1157059265 18:44268240-44268262 TTGGTTAACAAACCCTTGTCCGG - Intergenic
1158083520 18:53622877-53622899 TTGCTTAGTATACCTCTTCCTGG + Intergenic
1163504124 19:17694644-17694666 TTGTTTAAGAAATCCTTTCCCGG + Intergenic
1166166061 19:40989669-40989691 ATGTTAAGCAAACCCTTTGCTGG - Intergenic
926059785 2:9797977-9797999 TTGCTTAAGACACCCTTCCCTGG + Intergenic
929817204 2:45242774-45242796 GTGCTCTGAAAACCCTTTCCTGG - Intergenic
933405113 2:81848100-81848122 TTGTTTTCCAAACCATTTCCTGG - Intergenic
933827195 2:86172854-86172876 TTGCTCAGATAACCCCTTCCAGG + Intronic
935203187 2:100876219-100876241 TTGCTTAGCAACCTTTCTCCAGG + Intronic
938731857 2:134152865-134152887 TCTCTAAGCATACCCTTTCCAGG + Intronic
939589909 2:144052121-144052143 TTCTTCAGCAAACCCTTTACTGG - Intronic
939624931 2:144465129-144465151 GTTCTCAGAAAACCCTTTCCTGG + Intronic
941037585 2:160585010-160585032 CTACTTTGCAAACCCTCTCCAGG + Intergenic
944616893 2:201469954-201469976 TTGATGAGCCAACCCTTTCCTGG + Exonic
948845633 2:240681624-240681646 TTGCTGAGCAAAGGCTTTCGTGG + Intronic
948848222 2:240693106-240693128 TTGCTGAGCAAAGGCTTTCGTGG - Intronic
1172744016 20:37192797-37192819 TTCCTCAGGAAAGCCTTTCCTGG - Intronic
1174905285 20:54544039-54544061 TAGCTAAGCCAACCCTTTCCTGG - Intronic
1175389414 20:58616972-58616994 TTACTTAGCATAACATTTCCGGG + Intergenic
1179220516 21:39403095-39403117 TTACTCAGCATACCATTTCCAGG + Intronic
1180195512 21:46191343-46191365 TTGCTTAATTAGCCCTTTCCAGG - Intronic
1182900193 22:33891648-33891670 ATGCTTAGCAAACACATCCCTGG + Intronic
1183248573 22:36712184-36712206 TTGCCTAGAAAACCTTTCCCTGG - Intergenic
1183530032 22:38348365-38348387 GTGCTTAGCCAAGCCTGTCCTGG - Intronic
949960250 3:9305923-9305945 TGACTTAGCAAACCCATTGCTGG - Intronic
950313937 3:11983884-11983906 TGGCTTAGAAGACCATTTCCTGG + Intergenic
957489372 3:80904766-80904788 TTGCATAGCAAATACCTTCCTGG - Intergenic
957952306 3:87142015-87142037 TTGCTAAACAAATCCTTGCCAGG - Intergenic
960004266 3:112766032-112766054 TAGCTTATCAACACCTTTCCTGG + Intronic
961623706 3:128244365-128244387 GTGCTCCACAAACCCTTTCCTGG - Intronic
968480111 4:829470-829492 GTGCTTCCCAGACCCTTTCCTGG - Intergenic
970652146 4:18190687-18190709 TTCCTTATCAATCTCTTTCCAGG + Intergenic
976459296 4:85289758-85289780 TTGCCTAGCAATCCCATTACTGG + Intergenic
979223715 4:118260520-118260542 TTACTTAGCAATCCCTTTCAAGG + Intergenic
981381513 4:144077342-144077364 TTGCTTAGTAAATACTTTCTGGG + Intergenic
981474827 4:145178359-145178381 TTGCTTACCAAACTCTTGCTAGG + Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982074561 4:151725631-151725653 TTGCTTAGCAAACCCTTTCCTGG - Intronic
982163328 4:152591659-152591681 CTGCTTAGCAATCCCTTCTCTGG + Intergenic
982209989 4:153026689-153026711 TTGTTTTGCTACCCCTTTCCTGG - Intergenic
982539282 4:156647441-156647463 TTGCTTAACAAAAGCTTTCAGGG - Intergenic
986056531 5:4142915-4142937 TTACTTAGCTCTCCCTTTCCCGG - Intergenic
988642532 5:33057171-33057193 TTGCCTAGAAAACCCTTCTCAGG - Intergenic
989151167 5:38301252-38301274 TTCCTTGGGAAACCCTCTCCTGG - Intronic
990383529 5:55237419-55237441 TTGCTTTGGGAAGCCTTTCCAGG - Intergenic
994030672 5:95138604-95138626 TTGGTTAGCAGACCTATTCCTGG - Intronic
995462193 5:112415544-112415566 TTGGTTAGCAAAACATTTTCAGG - Intronic
997933369 5:138089960-138089982 TTGCTTAAAAAACCTCTTCCTGG - Intronic
998085016 5:139313362-139313384 CTGCTTATCAGACCCTTGCCAGG - Intronic
999175562 5:149629434-149629456 CTTCTCAGCAAAACCTTTCCTGG - Intronic
1000422273 5:161052389-161052411 TTGTTCAGCAAACACTTTCCTGG - Intergenic
1000929894 5:167238913-167238935 TGCTTTAGCAAAGCCTTTCCTGG + Intergenic
1001101967 5:168821625-168821647 TTGCTTCCCAAATTCTTTCCTGG - Intronic
1001736717 5:174010654-174010676 TTGCTCAGCTATTCCTTTCCTGG + Intergenic
1005705041 6:28443227-28443249 TTGGTTAACAAAGCCCTTCCAGG + Intronic
1005964351 6:30716523-30716545 TTTCTCAGCAAACCCTTTCCTGG + Intronic
1006584001 6:35093751-35093773 TTGCTAAGCTGCCCCTTTCCTGG - Intergenic
1008143330 6:47858118-47858140 TTTCTAACCAAACACTTTCCAGG - Intergenic
1008638584 6:53437422-53437444 TTGCTTAGGGAAGCCTTCCCTGG + Intergenic
1008676314 6:53822920-53822942 TTGCTCTGACAACCCTTTCCAGG - Intronic
1010015644 6:71102961-71102983 TGGCTTAGCAAAGCCTTCCTTGG + Intergenic
1010712254 6:79188886-79188908 TGGCATAGCAAAGCCTTTTCTGG + Intergenic
1011985327 6:93436532-93436554 TTACTCAGCAATCCCTTTACTGG + Intergenic
1012894693 6:104935491-104935513 TGACTTAGCAATCCCTTTCCTGG - Intergenic
1016255782 6:142103423-142103445 TTGGTTATCAAACTCATTCCTGG - Intergenic
1021573849 7:22090393-22090415 GGGCTCAGCAAACCCATTCCAGG + Intergenic
1022097446 7:27149623-27149645 ATGCAAAGTAAACCCTTTCCAGG - Intronic
1025944448 7:66095220-66095242 TTGCTGAACCTACCCTTTCCTGG + Intronic
1026212059 7:68314435-68314457 GTGCTTGGCAGACCCTTTGCTGG - Intergenic
1027434431 7:78149839-78149861 TTGTAGAGCAAACCCTTGCCTGG + Intronic
1027869949 7:83694325-83694347 AAGCTTTGCAAACCATTTCCAGG - Intergenic
1030976584 7:116131745-116131767 TTGCTTAGCAAACTCTTTAAGGG - Intronic
1031536078 7:122934940-122934962 ATGCTTTGCAAAACCTTTGCAGG - Intergenic
1032497894 7:132376579-132376601 TTGCTGAGCAAATCGCTTCCTGG - Intronic
1034189523 7:149203062-149203084 TTCCTCAGCAAAACATTTCCTGG + Intronic
1038018407 8:23533434-23533456 GTGCTTCCCAAACCTTTTCCTGG + Intronic
1038466719 8:27771733-27771755 TTGCTTAGCTATTCCTTTCCTGG - Intronic
1040064550 8:43134555-43134577 TTGCTAAACAAAGCCTTACCAGG - Intergenic
1040481542 8:47831826-47831848 TTGCTCAGCAACGCCTTTTCTGG + Exonic
1042680154 8:71374626-71374648 TGACTTAGCAATCCCTTTGCTGG + Intergenic
1043876987 8:85496682-85496704 TGGCTTAGCTATCACTTTCCTGG + Intergenic
1048110003 8:131457709-131457731 TTTCTTAACAAATCCTTTGCTGG - Intergenic
1057882923 9:98807180-98807202 TTGAATAGCAAACCCTCGCCTGG - Intergenic
1060714924 9:125916463-125916485 TTGCCTAGCATTCCCTGTCCTGG - Intronic
1060790436 9:126482223-126482245 TGGCTCAGCAAACCCGTTTCTGG + Intronic
1061229015 9:129301449-129301471 TTGCTAGGCAGCCCCTTTCCTGG + Intergenic
1061850746 9:133413692-133413714 TTCCTTAGAAAAGCCATTCCTGG + Intronic
1062258874 9:135647520-135647542 TTGCTGAGCAACTCCTTTTCTGG + Intergenic
1062360403 9:136185514-136185536 TTCCTTAACAAACCCTTTGAGGG - Intergenic
1185945074 X:4366216-4366238 TTGCTTACATAAACCTTTCCAGG - Intergenic
1189666763 X:43364002-43364024 TTTTTTAGCAAAGCCTTTCCTGG + Intergenic
1196388402 X:115184829-115184851 TAGCATAGCAAACCCTATGCAGG + Intronic
1197629370 X:128840819-128840841 TTGCTCAGCAAACCATTTGAAGG + Intergenic
1198608844 X:138374257-138374279 TTTCTTAGCACAGCCTTTGCTGG + Intergenic
1200079578 X:153569386-153569408 CTGCTCAGCAAACCCTCTCTCGG + Intronic