ID: 982076788

View in Genome Browser
Species Human (GRCh38)
Location 4:151745692-151745714
Sequence CAGAATAAGGGGAATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 464}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982076788 Original CRISPR CAGAATAAGGGGAATGAAGA GGG (reversed) Intronic
900170253 1:1264429-1264451 CAGAGCAAGGGGAAAGATGATGG - Intronic
900731175 1:4261642-4261664 CAGGAAAACAGGAATGAAGAAGG + Intergenic
901269636 1:7941983-7942005 GAGTATAAGGAGAAAGAAGAGGG + Intronic
901329061 1:8390516-8390538 CAGAACTTGGGGAAGGAAGAAGG + Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902795159 1:18796128-18796150 CAGAATAAGGGTGAAGAAGGGGG - Intergenic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904846377 1:33421267-33421289 CAGGAAAAGAGGAATAAAGACGG + Intronic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
904916586 1:33974914-33974936 CCTAATAAGGCAAATGAAGAGGG + Intronic
905034681 1:34910048-34910070 AAGAATAAGGGGAGGAAAGATGG - Intronic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905284930 1:36873123-36873145 CAGGATGAGGGGAATGAGGTGGG - Intronic
905343203 1:37293337-37293359 CAGAAGGAGGGGGATGAAGGGGG - Intergenic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906324923 1:44839601-44839623 GAGAATGTGGGGAATGGAGAGGG + Intronic
906664542 1:47610039-47610061 CAGAATTTGGGCAAAGAAGAAGG + Intergenic
906784494 1:48602829-48602851 AAGAAGAAAAGGAATGAAGAGGG - Intronic
907766117 1:57412212-57412234 CAGAGGAAGGGGAAAGTAGACGG - Intronic
908139465 1:61169287-61169309 CAGAATAGTGGGAAGGAAAAAGG - Intronic
910261223 1:85295582-85295604 CAGAAAAAGGGGTATGTAGTTGG - Intergenic
911583447 1:99662065-99662087 AAGGAAAAGGGGAGTGAAGAAGG + Intronic
912261804 1:108118308-108118330 AAGAAAAAGAGGACTGAAGATGG + Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912359148 1:109080435-109080457 AAGAAAAAGGGGAAAGAAGTTGG + Intergenic
912554621 1:110507260-110507282 CAGAAAAAGGGAAAGAAAGACGG - Intergenic
912862659 1:113228316-113228338 AAGAATAAATGGAATCAAGAAGG + Intergenic
912881184 1:113416676-113416698 CAGAATAAGGGAGATTATGAAGG + Intronic
913437976 1:118866740-118866762 GAGAAGAAGGGGAAGGAAGAAGG + Intergenic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914956436 1:152166933-152166955 CAGAGTATGGGGCAGGAAGATGG + Intergenic
915570821 1:156744260-156744282 GATAAGAAGGGGAATGCAGAGGG - Exonic
915796267 1:158737648-158737670 CAGGATAGTGGCAATGAAGATGG - Intergenic
917711728 1:177692149-177692171 CAGAATAAGAGGGGAGAAGAGGG + Intergenic
917794574 1:178523652-178523674 CAGAAATAGGGAAAAGAAGAAGG + Intronic
918713873 1:187765283-187765305 CAGAAAAAGCAGAATGAAAAAGG - Intergenic
918987285 1:191648831-191648853 CAAAATGAGGGGAAAAAAGATGG - Intergenic
919443770 1:197674587-197674609 CAGAGAAAAGGGAATGAAGTTGG + Intronic
919469599 1:197961740-197961762 AAGAAAAAGAGGGATGAAGAAGG - Intergenic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920652209 1:207846553-207846575 CAGAATAAGTACAATGAAAAAGG + Intergenic
921325929 1:213986267-213986289 CGGCAAAAGGGGAAAGAAGAAGG + Intronic
921568838 1:216754163-216754185 CAGAATATTTGGAAGGAAGAAGG - Intronic
922004656 1:221517608-221517630 CAGAATAAAGACAATGAACAAGG + Intergenic
923256714 1:232227877-232227899 CAAAAAGAGGAGAATGAAGAAGG + Intergenic
924843990 1:247746830-247746852 CAGAATAAGGGGACCTGAGAAGG - Intergenic
1063524870 10:6775625-6775647 AAGAAAAAGGGGAGAGAAGAAGG - Intergenic
1063545822 10:6980513-6980535 CAAAAAAAGAGGAAAGAAGAAGG - Intergenic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1064294958 10:14070540-14070562 CAGAAGAAGGGACATGATGATGG + Intronic
1064747711 10:18494165-18494187 CAGAAAGAGGGGACTGAAAAAGG - Intronic
1067078675 10:43202127-43202149 CAACTTAAGGGGAAGGAAGAAGG - Intronic
1068226228 10:54110008-54110030 AAGTACAAGTGGAATGAAGAAGG + Intronic
1068964715 10:62900487-62900509 GAGAATATGTGGAAAGAAGAAGG - Intronic
1070496786 10:77031715-77031737 CAGAGCAAGGTGAATGAACAGGG + Intronic
1070905977 10:80073496-80073518 CAGTATAATGAGAATGGAGAAGG - Intergenic
1071227664 10:83549752-83549774 CAAAATAAAAAGAATGAAGATGG - Intergenic
1071967657 10:90868625-90868647 CAGAATAGGGGAGATGAACAGGG - Intergenic
1072152455 10:92694524-92694546 CTGAATAAAGGAAATGAAAATGG - Intronic
1072548578 10:96459295-96459317 AAGAGCAAGGGCAATGAAGAAGG + Intronic
1073075486 10:100823626-100823648 GAGAATAAGGGGAATCTGGAGGG + Intronic
1074559425 10:114521898-114521920 CAGAACCAGGGGAGAGAAGATGG + Intronic
1075083781 10:119400744-119400766 AGGAATAAGGGGGATGAGGAAGG + Intronic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1077670873 11:4156504-4156526 AAGAATACAGGGAATGATGAGGG - Intergenic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1080441500 11:32298910-32298932 CAGAATAAGTGGAGTGAAAGAGG - Intergenic
1080992570 11:37556773-37556795 GAGAATAATGGGTTTGAAGAAGG - Intergenic
1081043742 11:38245411-38245433 GAGAATTTGGGGAATGAATATGG + Intergenic
1081389064 11:42507574-42507596 CAAAATAAGGAAAATGAAGAGGG + Intergenic
1081437011 11:43038205-43038227 CAGAATCAGGGGGTTGAAGTAGG - Intergenic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1081819839 11:45981766-45981788 GAGAATATGGGGGATGAAGTTGG - Intronic
1081878541 11:46428175-46428197 AAGAAGAAGGGGAATGGGGAGGG + Intronic
1082069908 11:47930960-47930982 CAGAAAAAGGAGGATGCAGAAGG - Intergenic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1082636449 11:55599982-55600004 CAGCATCAGGGGAGTGAAGCTGG + Intergenic
1083097634 11:60267776-60267798 CAGAGTTAAGGGAACGAAGAAGG + Intergenic
1084453610 11:69254588-69254610 CAGCCAAAGGGGAATGAGGAGGG + Intergenic
1084851118 11:71941752-71941774 CAAATTAATGGGAATGAACAAGG + Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085666057 11:78417048-78417070 CGGAATAAAGGGAAAGAAGGGGG + Intronic
1085803283 11:79611474-79611496 CAGGAGAAGGGAAATGCAGAAGG - Intergenic
1086358633 11:86033609-86033631 CAGAGTAAGGGGGATAATGAGGG - Intronic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1088078654 11:105882643-105882665 CAGAATAAGGGGAACGCAGTGGG - Intronic
1088522625 11:110715517-110715539 CATAATAATGGAGATGAAGATGG - Intergenic
1088624452 11:111719421-111719443 TTAAATAAGGGAAATGAAGAGGG - Intronic
1089294014 11:117457389-117457411 CAGAATAGGAGGCAAGAAGAAGG + Intronic
1089437419 11:118482084-118482106 CAGAATCAGGTGAGTGAGGAGGG + Exonic
1090410653 11:126507372-126507394 AAAAATAAGGGGAAAGAAAAAGG + Intronic
1090484096 11:127096646-127096668 CAGAATGAGGGAAAAGAGGAAGG + Intergenic
1090979962 11:131710994-131711016 GAGAATAAGGAGAGAGAAGAAGG - Intronic
1091096907 11:132831919-132831941 CAAAAGAAGGAAAATGAAGAGGG - Intronic
1092907757 12:13117347-13117369 CAGAATTAGGGGGAGGAACAAGG + Intronic
1093075600 12:14755322-14755344 CAGATTGAGGGAAAAGAAGATGG + Intergenic
1093971782 12:25382564-25382586 GAGAAGAAGGGGCATGAGGACGG + Intergenic
1094046997 12:26178443-26178465 CAGAATAAGGTAAATTAAGAAGG + Intronic
1094424553 12:30304831-30304853 CAGGAGAAGGGAATTGAAGATGG + Intergenic
1095302347 12:40599436-40599458 CAAAATAAGGAGAATTAAAAGGG - Intergenic
1096204003 12:49706763-49706785 CAGCAGAAGGGGGAGGAAGAAGG + Intronic
1096871191 12:54593351-54593373 CAGAATCAGGGGCATCAGGAAGG + Intergenic
1097078880 12:56414890-56414912 CAGAATAAGGAGAAATCAGACGG + Intergenic
1097625296 12:61992701-61992723 CAGAAAAAGGGGATTGGAGGAGG - Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100057083 12:90524866-90524888 CAGTATCATGAGAATGAAGAAGG - Intergenic
1100121918 12:91378482-91378504 CAGAATAAGGGGAAGTTTGAGGG - Intergenic
1102178444 12:110893483-110893505 CAGGACAAGGGGAAGAAAGAGGG - Intronic
1102425170 12:112838380-112838402 CAGACTAATGGGAGTGCAGAAGG - Intronic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103147689 12:118609638-118609660 GAGAAAGAGGGGGATGAAGAAGG + Intergenic
1104082421 12:125442001-125442023 CACCATTAGGGGAATGAAAATGG + Intronic
1105545281 13:21346605-21346627 GAGGATGAGGGGAATGAAGCGGG - Intergenic
1105652135 13:22390622-22390644 CAGCATAAAGAGAATGAAAAGGG - Intergenic
1106449474 13:29866983-29867005 CAGCAGAAGGGGAAAGAACATGG + Intergenic
1106772718 13:32978027-32978049 CAGAATAAAGGGAATTAACCAGG + Intergenic
1107045013 13:35984712-35984734 AAGAAGAAGGGGAATACAGATGG - Intronic
1107178535 13:37428654-37428676 AAGAAAAAGGGAAATGCAGAGGG + Intergenic
1107217053 13:37934328-37934350 CAGCACAAGGAGAATGGAGAAGG + Intergenic
1107662336 13:42651529-42651551 CAGAAGGAGGGGAAGGGAGAGGG - Intergenic
1108038822 13:46320601-46320623 GAGAAAAAGGACAATGAAGAGGG + Intergenic
1108861513 13:54865992-54866014 CAGAAAAAGGGGCCAGAAGAGGG - Intergenic
1109427396 13:62182949-62182971 AAGAATAGGGGGAAAGAAAATGG + Intergenic
1110150629 13:72248718-72248740 CAGAATAAGAGGAAAAAGGATGG + Intergenic
1110326529 13:74222532-74222554 TAAAATAAGGGGAATAAAGTTGG - Intergenic
1111003239 13:82213229-82213251 CAGAATATGGTGAATAAAGTTGG - Intergenic
1111007091 13:82262381-82262403 CAGGATGAAGGGAACGAAGATGG - Intergenic
1111633249 13:90870481-90870503 CAGAAGAAGGGGAAGGACAAGGG - Intergenic
1112150663 13:96758442-96758464 CAAAATAAGCTGAAAGAAGAAGG - Intronic
1112679458 13:101745851-101745873 CACACTTAGGGGAATGAAGATGG + Intronic
1113148246 13:107233011-107233033 AAGAATATGGGGACTGAAGGTGG - Intronic
1113330705 13:109324285-109324307 CACAATAAGGGCAGGGAAGAGGG + Intergenic
1114196827 14:20485499-20485521 CTGAACAAGGGGAATGGTGATGG + Intergenic
1114258171 14:21019816-21019838 CAGGATTTGGGGAAGGAAGAAGG - Intronic
1114641702 14:24227497-24227519 CAGAATGAGGGTAATGGAGATGG + Intronic
1114985422 14:28221395-28221417 CAGAATTATTGAAATGAAGATGG - Intergenic
1115787827 14:36846350-36846372 CTGAATAATGGAAATGATGATGG - Intronic
1116280599 14:42902292-42902314 CAGAGTAATAGAAATGAAGAAGG - Intergenic
1116670460 14:47834972-47834994 CAGAATAAGATGCATGGAGATGG - Intergenic
1117194858 14:53329647-53329669 CAGCAGAGGGGGAATGAGGATGG - Intergenic
1117426413 14:55602881-55602903 GAGAATAAGTGGAAAAAAGATGG - Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1118014997 14:61651352-61651374 GAGAATTAAGGGGATGAAGAGGG - Intronic
1118152927 14:63209120-63209142 AAGAATGAAGGCAATGAAGACGG - Intronic
1118376601 14:65182861-65182883 CAGAATAAGAGACTTGAAGAAGG - Intergenic
1120310987 14:82828255-82828277 CTGGATAAGGGGGCTGAAGATGG - Intergenic
1120476873 14:84999419-84999441 AAGAAGAAGGGCAATGAACAGGG - Intergenic
1120605941 14:86578045-86578067 AAGAACATGGGGAAAGAAGAGGG - Intergenic
1120853963 14:89196779-89196801 CAGAGGAAGCGGAATGAACATGG - Intronic
1124044157 15:26132679-26132701 CAGAATAAAGTTAATAAAGAAGG + Intergenic
1125099148 15:35890446-35890468 CAAAATGAGGGGCATGAAGGAGG + Intergenic
1125179912 15:36870876-36870898 GAGAATAAGGGGATTCCAGATGG + Intergenic
1126124796 15:45285480-45285502 CAGAATCAGGGTAATGTAGGTGG + Intergenic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128116999 15:65114414-65114436 CAGAATACAGGCAATGAGGAAGG - Intronic
1130241206 15:82193897-82193919 CAGAATGAGGAGAGTGAAGGCGG - Intronic
1130303628 15:82698848-82698870 CAGGAGAAGGGGAATGAAAGGGG + Intronic
1130356576 15:83137454-83137476 AAACATAAGGGGAATGTAGATGG - Exonic
1130459222 15:84147262-84147284 CAGAATGAGGAGAGTGAAGGCGG + Intergenic
1131150384 15:90043869-90043891 AAGAAAAAGGGGAAAAAAGAGGG - Intronic
1131514723 15:93069554-93069576 AAGTATAAGGGGAAGAAAGAAGG + Intronic
1131574843 15:93577888-93577910 CAAAATAAGGGAAAAAAAGAGGG + Intergenic
1131755070 15:95550711-95550733 GAGAGTAAGGGGAAAGGAGAGGG - Intergenic
1133087253 16:3374606-3374628 CAGAATTGGGGGAAAGAAGCAGG + Intronic
1133880770 16:9779554-9779576 AAGAAAAAGGGGAATGGAGAAGG + Intronic
1134431292 16:14209451-14209473 CAAAATAAGGGGAATACAGGAGG - Intronic
1135232054 16:20717812-20717834 AAGAAGAAGAGGAAGGAAGAAGG + Intronic
1135282975 16:21169303-21169325 CAGAAAAAGGGGAAAAAAAAAGG - Intronic
1138690395 16:58762430-58762452 CAGAAAAAGAAGAATGAAGTTGG - Intergenic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1141562647 16:84879769-84879791 CAGGATTATGGGAAGGAAGAAGG - Intronic
1143377301 17:6474344-6474366 CAGAATGAGGAGAGTGAAGTCGG - Intronic
1144027884 17:11294427-11294449 CAGGATAAGGGGCAGGGAGAAGG + Intronic
1144074253 17:11702689-11702711 CAAAATAAAGAGGATGAAGAAGG + Intronic
1144249440 17:13400773-13400795 CAGACTAAGGGAAAAGGAGATGG + Intergenic
1145415327 17:22709926-22709948 CAGGATGAGGGGATGGAAGATGG + Intergenic
1146138366 17:30343110-30343132 CAAACTTAGGGGAAGGAAGAGGG - Intergenic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1147422877 17:40331292-40331314 CAGCATAGGGGGGAAGAAGAAGG - Exonic
1147710261 17:42458605-42458627 CAGTATAAGGGGTAAGAAAAAGG + Intergenic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148006399 17:44434298-44434320 AAGAAAAAGGGGAAAGAAAAAGG + Intronic
1148368498 17:47074622-47074644 CTAAATAAGGGGAAAGAATAGGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148703738 17:49609484-49609506 GAGAAGAAGTGGAATGAAAACGG + Intronic
1148721220 17:49754648-49754670 GAGAAGAAGGGGAGGGAAGAGGG + Intronic
1148767359 17:50047043-50047065 CAGGATGAGGGCAATGATGAAGG - Intergenic
1149112856 17:53054601-53054623 AAGAATAAGTGGAATTAAGAAGG - Intergenic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150856512 17:68758440-68758462 AAGAATTAAGGGAATGAAAATGG + Intergenic
1151809336 17:76428178-76428200 CAAAAGACTGGGAATGAAGATGG - Intronic
1153135028 18:1907063-1907085 AAGAAGAAAGGGAAAGAAGAAGG - Intergenic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1155026624 18:21946469-21946491 CAGAAAAAGAGGCATGATGATGG - Intergenic
1155429779 18:25743168-25743190 CAGAATGAGGGAATTGAACAAGG + Intergenic
1157241021 18:46009517-46009539 CAGAATAAAGGGAACTTAGAGGG + Intronic
1158109435 18:53924211-53924233 CAGAATAAGAGGCAAGAAGGGGG + Intergenic
1158146962 18:54325155-54325177 CAGGATAAGGGAAATGAGGGAGG - Intronic
1158816286 18:61100976-61100998 CAGAATAAGGCATATGAGGAAGG + Intergenic
1159129251 18:64261217-64261239 TAGAATAAGAGGAATGTATATGG - Intergenic
1162359687 19:10211305-10211327 CAAAAAAAGGGAAATGAAGTGGG - Intronic
1162753499 19:12843367-12843389 CAGAATCAAGGGGATAAAGAGGG - Intronic
1162904709 19:13816875-13816897 GGGAATAAGGGCAATGAGGAGGG + Intronic
1163884648 19:19955107-19955129 AAGGAGAAGGGGAAAGAAGAAGG + Intergenic
1164323041 19:24167813-24167835 TAGAATTAGGAGAATGAAAAAGG - Intergenic
1164581343 19:29437225-29437247 CAGATGAATGGGAATGGAGAAGG + Intergenic
1165637254 19:37351290-37351312 CACAATATGGGGAATGAAAGAGG - Intronic
1165792018 19:38498337-38498359 CAGATTGAGGGGAAGGCAGAAGG + Intronic
1165935055 19:39384049-39384071 CAGAATGTGGGGAATGGTGAAGG - Exonic
1166346899 19:42172205-42172227 AGGAATCTGGGGAATGAAGATGG - Intronic
1167752893 19:51391112-51391134 CAGAGTACGGGGTCTGAAGAAGG - Intergenic
925693035 2:6544818-6544840 AAGAATAAGGAGCATGAAAATGG + Intergenic
926003942 2:9357046-9357068 TAGAATTAGAGGAATGAAAAGGG - Intronic
926369248 2:12163700-12163722 GAGAGGAAGGGGAATGAAGGAGG - Intergenic
926819320 2:16835212-16835234 CAGCATAAGGAGCATGCAGACGG - Intergenic
927064559 2:19458437-19458459 CAGAATAAGGAGATTTAAAAAGG + Intergenic
927273220 2:21237119-21237141 CAGAATTAAAGGAATCAAGATGG - Intergenic
927380054 2:22468856-22468878 AAGAATGTGGGGAAAGAAGAAGG - Intergenic
928079786 2:28300337-28300359 GAAAATAAAGGGAAAGAAGAAGG - Intronic
929840617 2:45458759-45458781 CAGACTTAAGGGAATGTAGAGGG - Intronic
930404415 2:50937277-50937299 CAAAAGAAGGGGAATGGAAAAGG - Intronic
931000296 2:57772740-57772762 AAGAAAAAGGGGAGAGAAGAAGG + Intergenic
931959179 2:67462873-67462895 CAGAGGATGGGGAAAGAAGAGGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
933026665 2:77268366-77268388 AAGTATAAAGGAAATGAAGAGGG - Intronic
934067179 2:88350890-88350912 CAGAACAAGTGGCAGGAAGAAGG - Intergenic
934110428 2:88737069-88737091 CAGAATGAGAGGAAAGAAGAGGG - Intronic
934151893 2:89154931-89154953 CAGAATAACGGGAATGAGCCTGG - Intergenic
934215367 2:90026976-90026998 CAGAATAACGGGAATGAGCCTGG + Intergenic
935066488 2:99652797-99652819 CAGAATCTAGGGAATGAGGAGGG - Intronic
936611758 2:114008537-114008559 CAGAATCAGGGAAGGGAAGAAGG + Intergenic
936986785 2:118319147-118319169 GAAAAGAAGGGGAAAGAAGAAGG - Intergenic
940023540 2:149181125-149181147 CAGATGAAGGGGAATTGAGAGGG - Intronic
940332468 2:152490178-152490200 CAAAAAAAGGGGAAAGAGGAGGG + Intronic
940705570 2:157101131-157101153 CAAAATAAAGGGATTGAGGAAGG - Intergenic
941198745 2:162483010-162483032 AAGGAGAATGGGAATGAAGAAGG + Intronic
941684208 2:168430992-168431014 CAGAATCTGGAAAATGAAGAGGG - Intergenic
941695590 2:168547848-168547870 TAGTAGAAGCGGAATGAAGATGG + Intronic
941717830 2:168782278-168782300 CAGCATGAGTTGAATGAAGAAGG + Intergenic
942690604 2:178581090-178581112 AAGAAGAAGGGAAATTAAGATGG + Intronic
945190523 2:207182864-207182886 CACACTTAGGGGAATGAGGAGGG + Intergenic
946085323 2:217164580-217164602 CAGAACTGGGGGAGTGAAGATGG + Intergenic
946566346 2:220970004-220970026 AAGAAGAAGGGAAATAAAGAAGG + Intergenic
947129914 2:226910952-226910974 CAAAATATGGGGAAAGAAAATGG - Intronic
947382583 2:229559627-229559649 CAGAAGAAAGGGAAGGAAGGAGG + Intronic
948002794 2:234581912-234581934 CAGATTGAGGGGAAAGAAAAGGG - Intergenic
949077934 2:242073269-242073291 CCGGTGAAGGGGAATGAAGAAGG + Intergenic
1170434931 20:16316583-16316605 CTGAATGACTGGAATGAAGAAGG + Intronic
1171937360 20:31287614-31287636 CAGAGGAAGGGGGATGAAAATGG + Intergenic
1172089214 20:32415760-32415782 AAGAGTAAGGGGAAGGAAAAAGG - Intronic
1172294405 20:33798454-33798476 CAGAGTAACCGCAATGAAGATGG + Intergenic
1172574456 20:35996967-35996989 CAGGAAATGGAGAATGAAGAAGG - Intronic
1172834665 20:37865291-37865313 AGGTACAAGGGGAATGAAGACGG + Intronic
1172891398 20:38268475-38268497 AAGGAGAGGGGGAATGAAGAAGG - Intronic
1173086066 20:39919447-39919469 CAAAATAAAGGGATGGAAGAAGG - Intergenic
1173416509 20:42861267-42861289 CAGAATCAAGGGAATTAACAAGG - Intronic
1173486180 20:43442861-43442883 CAGAAAAATGGGGATGAAGCTGG - Intergenic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174517672 20:51105375-51105397 CAGATTATGGGTAATGAACATGG - Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174722290 20:52825817-52825839 CAGAAAAGGAGGAATGAAGGTGG + Intergenic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1177861534 21:26460237-26460259 AAGAAAAAGGAGAGTGAAGATGG - Intergenic
1182262571 22:29085328-29085350 TGTAGTAAGGGGAATGAAGAGGG - Intronic
1183226767 22:36555715-36555737 CAGAATAATGGGTATGAATGAGG + Intergenic
1183972659 22:41489606-41489628 CAGAGTAAGGGAAATGCAGGAGG - Intronic
1184428294 22:44425855-44425877 GAGAAGCAGGGGATTGAAGAAGG - Intergenic
1184629973 22:45769451-45769473 CAGTATAGGGGGAATGGAGATGG + Intronic
949134039 3:540986-541008 CAGAATGGAGGGAAGGAAGAGGG - Intergenic
949547695 3:5086193-5086215 CAGAGCAATGGGAATGGAGAAGG + Intergenic
949833610 3:8244109-8244131 CAGGAAAAGGGGAAGGGAGAAGG + Intergenic
950122190 3:10489206-10489228 CAGATGAAGGGAGATGAAGAGGG - Intronic
951013967 3:17709008-17709030 CAGAACAAAGGCAAAGAAGAAGG - Intronic
951035584 3:17928353-17928375 AAGAATAAGTGTAAGGAAGAAGG + Intronic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
953371496 3:42392365-42392387 CAGCTAAAGGTGAATGAAGAAGG + Intergenic
955068449 3:55552413-55552435 AAGAATGAGGGGGAGGAAGAAGG - Intronic
955206447 3:56900012-56900034 CCCAAAAAGGGGAAGGAAGAAGG - Intronic
956013852 3:64860278-64860300 GATAATAAGGGGAGTGAACAAGG + Intergenic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
957338684 3:78864470-78864492 CACAAAAAAGGGAATAAAGAAGG + Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957936802 3:86954802-86954824 AAGAATAAAGGAAAGGAAGAAGG + Intronic
959755800 3:109897515-109897537 AAGAATTAGGGAAATGAAGCAGG - Intergenic
960708942 3:120507790-120507812 CAGGATAATAGGAATGTAGAGGG + Intergenic
960854333 3:122087232-122087254 CAGAATAAGGTCTATGAATAAGG - Intronic
962276377 3:134017758-134017780 GAGAAGAGGGAGAATGAAGAGGG + Intronic
962531529 3:136285319-136285341 CAGTATAAGGGTCCTGAAGAAGG - Intronic
962629463 3:137261042-137261064 TAGAATAAGTGGATTGAAAAGGG + Intergenic
963659178 3:148102908-148102930 CAGAAAAAAGGAAAGGAAGAAGG - Intergenic
964125606 3:153231149-153231171 CAGAATAAGGGAGAAGAAGGAGG + Intergenic
964181725 3:153895612-153895634 CAGAATAATGAGAATGTGGAAGG - Intergenic
964435196 3:156643919-156643941 CAGAGGCAGGGGAATGAGGAAGG - Intergenic
965783525 3:172313061-172313083 GAGAAAAAGGGGAAAGAAGAGGG - Intronic
966185639 3:177224202-177224224 CAGAATAAGTAGCATGATGAAGG - Intergenic
966631123 3:182076260-182076282 CAGAATGGGTGAAATGAAGATGG - Intergenic
966714636 3:183002822-183002844 CAGATCATGGGGAATGAATAGGG - Intergenic
966798883 3:183743856-183743878 TAGAAGAAAGGGAATGAAAAAGG - Intronic
968001517 3:195209813-195209835 CAGAGTAAGGGGACAGAAAACGG + Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
971048320 4:22831163-22831185 CTTAATTAGGGGAATGAAGTGGG - Intergenic
971812897 4:31450487-31450509 CAGGATAAAGGGGATGAACAAGG - Intergenic
972084480 4:35197927-35197949 CAGAATTAGAGGAACAAAGATGG + Intergenic
972298380 4:37761954-37761976 AGGAATAAGGGGAATGATTATGG - Intergenic
972366345 4:38378713-38378735 CAGAATAAAGAAAATAAAGACGG + Intergenic
972574251 4:40337566-40337588 CTGAAAAAGGGGCATGTAGATGG - Intronic
973194337 4:47422508-47422530 GAGAACAGGGGGAATGAAGAAGG - Intronic
974483218 4:62472717-62472739 CAAAATATTGGGAATGAAAAAGG - Intergenic
975357367 4:73424002-73424024 CAGAAAAAGAGAAATGGAGATGG + Intergenic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
977805639 4:101294135-101294157 CAGAAGAAGTGGAATGGAGATGG + Intronic
978751098 4:112248796-112248818 CAGAATGGCTGGAATGAAGAAGG - Intronic
980709825 4:136550506-136550528 CAGAAAAAGAGGAACAAAGATGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
981291331 4:143079779-143079801 TAGAGTAAGGCCAATGAAGATGG - Intergenic
981610262 4:146586358-146586380 GAGAATAAGAGGGATAAAGAGGG - Intergenic
982076788 4:151745692-151745714 CAGAATAAGGGGAATGAAGAGGG - Intronic
984789324 4:183600448-183600470 CAGAGAAAAGGGAATGGAGATGG + Intergenic
985161478 4:187048857-187048879 CAGGAGAAGGGGAATGAAGGTGG + Intergenic
986279082 5:6308200-6308222 GAGAATAAGAGGAAGAAAGAAGG + Intergenic
987334528 5:16887152-16887174 CAGGATAAGGGGAAGGAATGTGG - Intronic
987827782 5:23055847-23055869 GAGAATAAGGAGAGTGAAGGAGG + Intergenic
988770167 5:34425386-34425408 CAGAAAAAAGGAAAAGAAGAAGG - Intergenic
989845291 5:46133139-46133161 CAAAATAAAGGGATGGAAGAGGG + Intergenic
989847230 5:46159983-46160005 CAAAATAAAGGGATGGAAGAAGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990384176 5:55243313-55243335 CAGAATAAAGGGAAAGATGTTGG + Intergenic
990403675 5:55466288-55466310 CAGACTAAGGTCCATGAAGATGG + Intronic
990734612 5:58846341-58846363 CTGAACAATGGGAATCAAGAGGG - Intronic
991601054 5:68351508-68351530 CAGGATAAGGGGAAAGGAGAAGG - Intergenic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993378900 5:87183170-87183192 CAGAGTAAAGGGGATGAGGAGGG + Intergenic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
994181484 5:96771554-96771576 CAGAATTAGGGGACAAAAGATGG - Intronic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994860638 5:105188147-105188169 AAGAACAAAGGGAATGGAGAAGG - Intergenic
995758269 5:115536058-115536080 CAGTTTCAGGGGAATGAGGAGGG + Intronic
996403932 5:123089031-123089053 CAGAAGAAGGGGAGGGGAGAGGG - Intergenic
997184401 5:131866929-131866951 AGGACTAATGGGAATGAAGAAGG - Intronic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
998188197 5:139999228-139999250 CGGCATAAGGGGAATGAGGCAGG - Intronic
998661966 5:144248670-144248692 CATGATAATAGGAATGAAGAAGG + Intronic
999243431 5:150140483-150140505 CAGAATAGGAGGAATCAGGAGGG - Intronic
999806049 5:155082333-155082355 GAGAATAAAGGGATTGAAGGAGG + Intergenic
999847625 5:155502360-155502382 TAGAAAAAAGGGGATGAAGATGG + Intergenic
999936722 5:156494721-156494743 CAGAAAAGTGGGAAGGAAGAAGG - Intronic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1000814297 5:165900932-165900954 AAAAAGAAAGGGAATGAAGATGG - Intergenic
1000927310 5:167209694-167209716 CAGAATTGGGGGAATGATGTGGG - Intergenic
1001695900 5:173669598-173669620 CAGAAAAAGAGGAAAGAAGGAGG - Intergenic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1004345294 6:14843703-14843725 CAGACCAAGGGAAAAGAAGAGGG - Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1005084798 6:21993944-21993966 CAGAGAAAGGGTAATAAAGATGG + Intergenic
1005366385 6:25082552-25082574 GAGAATAAGGAGAGTTAAGAGGG - Intergenic
1006080216 6:31560729-31560751 AAGAATAATGAGATTGAAGAGGG + Intergenic
1006278766 6:33029323-33029345 CAGAATAATGAGAATTAATACGG - Intergenic
1006535363 6:34695618-34695640 CAGAATGCTGGGAATGGAGAGGG - Intronic
1007394564 6:41570219-41570241 AAGAAAAAGGAGAATGCAGAAGG - Intronic
1009943316 6:70315134-70315156 CAGAGTAATAGGAATGAACATGG - Intergenic
1010587518 6:77671755-77671777 TAGATGAAGGGGAATGAACAGGG + Intergenic
1010738954 6:79476707-79476729 CAGAGAGAGGAGAATGAAGAAGG + Intergenic
1010996711 6:82541692-82541714 CAGAATAAGGGCAATCATTATGG + Intergenic
1011125420 6:84002386-84002408 CAGCAAATGGGGAAGGAAGAGGG - Intergenic
1011497056 6:87947285-87947307 AAGAATAAGGGGAAGAAAAAAGG - Intergenic
1011521017 6:88206443-88206465 GAGAATATGGAGAATGCAGAGGG + Intergenic
1012156230 6:95822663-95822685 CAGAATAAGGGAAATAACCAAGG + Intergenic
1012385664 6:98679083-98679105 TATACTAAGGGGAATGAACATGG - Intergenic
1013034725 6:106370290-106370312 CAGAAGAAGGGGTACGAAGTAGG - Intergenic
1013658587 6:112271253-112271275 GAGAATAAGGGTAGTGATGAAGG - Intergenic
1014002498 6:116380438-116380460 CAGAAGAGGGGGAATGAATTGGG + Intronic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1014725731 6:124969788-124969810 GATAATAAGGGCAATGGAGAAGG + Intronic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1015607319 6:134971752-134971774 CAGAGTAAAGGTAATGAATAAGG + Intronic
1015951868 6:138561476-138561498 TAGGATTAGTGGAATGAAGAGGG - Intronic
1016299839 6:142618437-142618459 AAGAATCTGGGGACTGAAGATGG - Intergenic
1016444375 6:144117555-144117577 TAGAATTAGGGGAAGGAAAAAGG - Intergenic
1016578450 6:145599408-145599430 CAGAACAAAGAGAATAAAGAAGG - Intronic
1016598511 6:145828614-145828636 CAGAGAACGGGGAAGGAAGAGGG + Intergenic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017096888 6:150812567-150812589 CAGAAAAAGGGGGATTAAGAAGG + Intronic
1017268316 6:152477353-152477375 CAGAAAAGGGTGGATGAAGAGGG + Intronic
1017344827 6:153368836-153368858 CAGAATAAGGAAAATTACGAGGG - Intergenic
1017504039 6:155051211-155051233 GAGAATAAGAAGAATGGAGATGG + Intronic
1017635743 6:156441534-156441556 GAGAAGAAGAGGAATGAAGCAGG + Intergenic
1018529882 6:164751398-164751420 CAGAATCAGGGGAAGCCAGATGG + Intergenic
1019574658 7:1731345-1731367 CAGAAAAGGGAGAATGATGAAGG + Intronic
1022924268 7:35044297-35044319 GAGAAGAAGGGGCAGGAAGAGGG - Intergenic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023460760 7:40393747-40393769 CTGAAGGAAGGGAATGAAGATGG + Intronic
1023643719 7:42287629-42287651 CAGAAGAGGGAGAATAAAGATGG - Intergenic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1023895209 7:44427395-44427417 CAGAATAAGGGGAGCAAGGATGG + Intronic
1024204209 7:47141615-47141637 CAGTATCAGGGGCAGGAAGAGGG - Intergenic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1026321481 7:69271718-69271740 CAGAAAAAGAGGAAGGAAAAAGG - Intergenic
1026494414 7:70890139-70890161 TAAAATAAGGGGAATGGAGCAGG + Intergenic
1027664649 7:81030306-81030328 GAGAATAATGGGAATAAGGATGG - Intergenic
1027893539 7:84009799-84009821 AAGTAGAAGGGGAAGGAAGAAGG + Intronic
1027967554 7:85032050-85032072 CAAAAACAGTGGAATGAAGAGGG - Intronic
1028313202 7:89365041-89365063 CAGCATTAAGGGAATGAAAATGG - Intergenic
1028451799 7:90993514-90993536 AAGAAGAAGGGGAAGGAAGGAGG + Intronic
1029011781 7:97269732-97269754 TAGATTATTGGGAATGAAGAAGG - Intergenic
1029677068 7:102077136-102077158 TAGAATAAGGTGAATCAAGCAGG + Intronic
1029822576 7:103160063-103160085 GAGAAGAAGGGGCAGGAAGACGG - Intergenic
1030561707 7:111095131-111095153 CAGGAGACGGGGAATAAAGAGGG + Intronic
1030653374 7:112139786-112139808 CAGAATAGGAGGTTTGAAGAGGG + Intronic
1031216672 7:118901390-118901412 CAGAAAATGGGGAATGAAGGTGG - Intergenic
1031798157 7:126205164-126205186 AAGAAGATGGGGAATAAAGAAGG - Intergenic
1032346160 7:131118738-131118760 CAGAAGAAAGAGAATGAAGGGGG + Intronic
1033536812 7:142320363-142320385 CCGAAGAGGGAGAATGAAGATGG + Intergenic
1033547552 7:142415333-142415355 CAGAATTGGGGGAAAGAATAAGG - Intergenic
1034218800 7:149428757-149428779 CAGAACAAGGGGAGAGACGATGG + Intergenic
1034850579 7:154489674-154489696 GAGAAGAGGGGGAATGAATAAGG - Intronic
1036505524 8:9351499-9351521 CAGAAAAAAGGCAAAGAAGATGG - Intergenic
1038313124 8:26461154-26461176 AAGAAGGAGGGGAATGAAGGAGG + Intronic
1038421515 8:27436943-27436965 AAGAAGAAGGGGAGTGGAGAAGG + Intronic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1040527421 8:48237168-48237190 TAGAATTAGGAGAATGAAAATGG - Intergenic
1040794010 8:51269718-51269740 CAAAATAAGGTTATTGAAGATGG - Intergenic
1041378121 8:57222923-57222945 CTGAATAAGGGGGACCAAGAGGG + Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042454401 8:68983814-68983836 TGGAAGAAGGGGAATGAAGTCGG + Intergenic
1042603938 8:70527540-70527562 CAGAGAATGGGGAATCAAGATGG - Intergenic
1042729118 8:71911760-71911782 CAAAATAAGGGAAAAGAAGGCGG + Intronic
1042890973 8:73609673-73609695 AATTATAAGGGGAATGAAGAGGG + Intronic
1043472169 8:80573794-80573816 CAGACTAAGGGAAAAGGAGATGG + Intergenic
1043499207 8:80836444-80836466 TAGAATATGGGGAATGAGGAGGG - Intronic
1043779811 8:84317990-84318012 CAGACTAAGGTGAATATAGAAGG - Intronic
1044707424 8:95022318-95022340 GAGAAAAAGAGTAATGAAGAAGG + Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045112174 8:98946629-98946651 CAGAGAAAAGGGAAAGAAGATGG + Intronic
1045337696 8:101223738-101223760 CATGATAAGGGGATTAAAGAAGG + Intergenic
1045778970 8:105841245-105841267 AAGGAGAAGGGGAATGAAGGAGG - Intergenic
1046124306 8:109884944-109884966 CAGAATAAAGATAATGAAGAAGG - Intergenic
1047535941 8:125719650-125719672 CAGAAGGTGTGGAATGAAGAAGG - Intergenic
1047749087 8:127866509-127866531 CAGCATCAGAGGAATGAAGGAGG + Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048534325 8:135278200-135278222 CAGAATAAGGGGGACTATGAGGG - Intergenic
1048750502 8:137668176-137668198 CAGAACAAAGAGAATGAAGTAGG + Intergenic
1049037230 8:140086230-140086252 CAGAGTATGGAGGATGAAGAAGG + Intronic
1050188183 9:2997203-2997225 CAGAGTTAGGAGAATAAAGAAGG - Intergenic
1050731548 9:8714779-8714801 CAGAGTAAGGGAAATCAGGAGGG - Intronic
1050958780 9:11700301-11700323 CAGAATAATCTGAATAAAGAGGG - Intergenic
1052033797 9:23657672-23657694 CAGAATCAAGGGTATGAAGTAGG - Intergenic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1053264555 9:36701196-36701218 CTGAATAAAGGGCAAGAAGATGG + Intergenic
1055043599 9:71901706-71901728 TTGAATGAGAGGAATGAAGAGGG - Intronic
1055189410 9:73499012-73499034 AAGAAAAAGGGGATTGGAGAGGG - Intergenic
1055568848 9:77595952-77595974 CAGGATAAGGAGAATAGAGATGG + Intronic
1055812416 9:80164485-80164507 CACAAAAAAGGGAATGAAAAAGG + Intergenic
1056615871 9:88165011-88165033 CCAAATAAGGGGAAAGAAGTGGG - Intergenic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1058314868 9:103553593-103553615 TAGATGAAGGGGAAAGAAGATGG + Intergenic
1058575882 9:106400762-106400784 CCCAATGAGAGGAATGAAGAAGG - Intergenic
1059148089 9:111920309-111920331 AAGACTAAGGTTAATGAAGAAGG - Intronic
1060651094 9:125327930-125327952 CATAATGAGGGGAGAGAAGAGGG - Intronic
1060732346 9:126046714-126046736 AGGAAGAAGGGGAAGGAAGAGGG - Intergenic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1185626728 X:1487803-1487825 CAGAATACGGGTAAAAAAGAAGG + Intronic
1186623609 X:11268108-11268130 CAGAATAAGAGCCAAGAAGAAGG - Intronic
1187311844 X:18152126-18152148 CAGAAAGGGGGAAATGAAGAAGG + Intergenic
1189328918 X:40130868-40130890 CAGGATGAGGGGCATTAAGAGGG - Intronic
1189645890 X:43131021-43131043 CAGAAGCAGGAGAAAGAAGAAGG + Intergenic
1189947082 X:46190468-46190490 GAGAAGAAGGGGGATGAGGAGGG - Intergenic
1190819380 X:53959381-53959403 CAGAATTAGGTGAATCTAGAAGG - Intronic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1194755162 X:97730759-97730781 AAGAAAAGGGGGAATGAAGAAGG - Intergenic
1195235556 X:102894017-102894039 CAGAGTAAGAGGAATGCTGAGGG + Intergenic
1195319477 X:103710031-103710053 TAGAGAATGGGGAATGAAGAGGG + Intronic
1195436736 X:104852958-104852980 CAGAAAAAGGGGTATGAGCAGGG + Intronic
1196812256 X:119638094-119638116 AAGAATAAGGGGAAAGAACTAGG + Intronic
1196934275 X:120714088-120714110 CAGAAAATGGGGAAGGCAGAAGG - Intergenic
1198647964 X:138830088-138830110 CAGAAAATGGGTAATAAAGACGG + Intronic
1198978011 X:142359021-142359043 CAGAAGAAGATGAAAGAAGAAGG - Intergenic
1199264658 X:145817175-145817197 AAGAATAAAGGGAATCAAAATGG + Intergenic
1199328588 X:146531453-146531475 AAGAAAAAGGAGAATGAATAAGG + Intergenic
1199437271 X:147826855-147826877 AAGTATAATGGGAAGGAAGAGGG - Intergenic
1199784317 X:151090749-151090771 CAGATGCAGGGGTATGAAGAGGG + Intergenic