ID: 982083213

View in Genome Browser
Species Human (GRCh38)
Location 4:151810028-151810050
Sequence CCAGATTAGCAGACAATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982083213_982083218 30 Left 982083213 4:151810028-151810050 CCTTGCATTGTCTGCTAATCTGG No data
Right 982083218 4:151810081-151810103 CCACCAGTAGATGAGTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982083213 Original CRISPR CCAGATTAGCAGACAATGCA AGG (reversed) Intergenic
No off target data available for this crispr