ID: 982084341

View in Genome Browser
Species Human (GRCh38)
Location 4:151818344-151818366
Sequence ACATCTGTGGGCCCCAGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982084341_982084347 9 Left 982084341 4:151818344-151818366 CCCTTGCTGGGGCCCACAGATGT No data
Right 982084347 4:151818376-151818398 CCCCAATTCTAAGTGCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982084341 Original CRISPR ACATCTGTGGGCCCCAGCAA GGG (reversed) Intergenic
No off target data available for this crispr