ID: 982087288

View in Genome Browser
Species Human (GRCh38)
Location 4:151848618-151848640
Sequence CAATAGAAATGGAAAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982087280_982087288 20 Left 982087280 4:151848575-151848597 CCCACCTTTTCAGGCTACAGAGA No data
Right 982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG No data
982087279_982087288 21 Left 982087279 4:151848574-151848596 CCCCACCTTTTCAGGCTACAGAG No data
Right 982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG No data
982087283_982087288 16 Left 982087283 4:151848579-151848601 CCTTTTCAGGCTACAGAGAAGGG No data
Right 982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG No data
982087281_982087288 19 Left 982087281 4:151848576-151848598 CCACCTTTTCAGGCTACAGAGAA No data
Right 982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982087288 Original CRISPR CAATAGAAATGGAAAGCAGA TGG Intergenic
No off target data available for this crispr