ID: 982090479

View in Genome Browser
Species Human (GRCh38)
Location 4:151876039-151876061
Sequence TGTCCCATCATCTCAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982090479_982090491 24 Left 982090479 4:151876039-151876061 CCCCCCACTGAGATGATGGGACA No data
Right 982090491 4:151876086-151876108 ATAGAGACCAAGTTACTTTCTGG No data
982090479_982090488 1 Left 982090479 4:151876039-151876061 CCCCCCACTGAGATGATGGGACA No data
Right 982090488 4:151876063-151876085 GGTGCAGGAGACAGAGGACCCGG No data
982090479_982090487 -5 Left 982090479 4:151876039-151876061 CCCCCCACTGAGATGATGGGACA No data
Right 982090487 4:151876057-151876079 GGACAGGGTGCAGGAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982090479 Original CRISPR TGTCCCATCATCTCAGTGGG GGG (reversed) Intergenic
No off target data available for this crispr