ID: 982093006

View in Genome Browser
Species Human (GRCh38)
Location 4:151896691-151896713
Sequence CAGAAGTACAAGAGGGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982092995_982093006 11 Left 982092995 4:151896657-151896679 CCCTTGCCCAAGGAAGGACCAGG No data
Right 982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG No data
982092994_982093006 12 Left 982092994 4:151896656-151896678 CCCCTTGCCCAAGGAAGGACCAG No data
Right 982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG No data
982092999_982093006 4 Left 982092999 4:151896664-151896686 CCAAGGAAGGACCAGGACTCACC No data
Right 982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG No data
982093000_982093006 -7 Left 982093000 4:151896675-151896697 CCAGGACTCACCATTCCAGAAGT No data
Right 982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG No data
982092997_982093006 10 Left 982092997 4:151896658-151896680 CCTTGCCCAAGGAAGGACCAGGA No data
Right 982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG No data
982092998_982093006 5 Left 982092998 4:151896663-151896685 CCCAAGGAAGGACCAGGACTCAC No data
Right 982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982093006 Original CRISPR CAGAAGTACAAGAGGGAATA GGG Intergenic
No off target data available for this crispr