ID: 982094808

View in Genome Browser
Species Human (GRCh38)
Location 4:151912108-151912130
Sequence CAGCCTCAGGGCTGTAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982094808_982094820 25 Left 982094808 4:151912108-151912130 CCTGAGCTACAGCCCTGAGGCTG No data
Right 982094820 4:151912156-151912178 CTGAGAGACCAAGAGGCAGTGGG No data
982094808_982094821 26 Left 982094808 4:151912108-151912130 CCTGAGCTACAGCCCTGAGGCTG No data
Right 982094821 4:151912157-151912179 TGAGAGACCAAGAGGCAGTGGGG No data
982094808_982094815 18 Left 982094808 4:151912108-151912130 CCTGAGCTACAGCCCTGAGGCTG No data
Right 982094815 4:151912149-151912171 CCCATCCCTGAGAGACCAAGAGG No data
982094808_982094819 24 Left 982094808 4:151912108-151912130 CCTGAGCTACAGCCCTGAGGCTG No data
Right 982094819 4:151912155-151912177 CCTGAGAGACCAAGAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982094808 Original CRISPR CAGCCTCAGGGCTGTAGCTC AGG (reversed) Intergenic
No off target data available for this crispr