ID: 982094812 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:151912139-151912161 |
| Sequence | TCTCAGGGATGGGTCACTCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 982094812_982094820 | -6 | Left | 982094812 | 4:151912139-151912161 | CCCTGAGTGACCCATCCCTGAGA | No data | ||
| Right | 982094820 | 4:151912156-151912178 | CTGAGAGACCAAGAGGCAGTGGG | No data | ||||
| 982094812_982094821 | -5 | Left | 982094812 | 4:151912139-151912161 | CCCTGAGTGACCCATCCCTGAGA | No data | ||
| Right | 982094821 | 4:151912157-151912179 | TGAGAGACCAAGAGGCAGTGGGG | No data | ||||
| 982094812_982094819 | -7 | Left | 982094812 | 4:151912139-151912161 | CCCTGAGTGACCCATCCCTGAGA | No data | ||
| Right | 982094819 | 4:151912155-151912177 | CCTGAGAGACCAAGAGGCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 982094812 | Original CRISPR | TCTCAGGGATGGGTCACTCA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||