ID: 982094812

View in Genome Browser
Species Human (GRCh38)
Location 4:151912139-151912161
Sequence TCTCAGGGATGGGTCACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982094812_982094820 -6 Left 982094812 4:151912139-151912161 CCCTGAGTGACCCATCCCTGAGA No data
Right 982094820 4:151912156-151912178 CTGAGAGACCAAGAGGCAGTGGG No data
982094812_982094821 -5 Left 982094812 4:151912139-151912161 CCCTGAGTGACCCATCCCTGAGA No data
Right 982094821 4:151912157-151912179 TGAGAGACCAAGAGGCAGTGGGG No data
982094812_982094819 -7 Left 982094812 4:151912139-151912161 CCCTGAGTGACCCATCCCTGAGA No data
Right 982094819 4:151912155-151912177 CCTGAGAGACCAAGAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982094812 Original CRISPR TCTCAGGGATGGGTCACTCA GGG (reversed) Intergenic
No off target data available for this crispr