ID: 982094820

View in Genome Browser
Species Human (GRCh38)
Location 4:151912156-151912178
Sequence CTGAGAGACCAAGAGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982094808_982094820 25 Left 982094808 4:151912108-151912130 CCTGAGCTACAGCCCTGAGGCTG No data
Right 982094820 4:151912156-151912178 CTGAGAGACCAAGAGGCAGTGGG No data
982094813_982094820 -7 Left 982094813 4:151912140-151912162 CCTGAGTGACCCATCCCTGAGAG No data
Right 982094820 4:151912156-151912178 CTGAGAGACCAAGAGGCAGTGGG No data
982094811_982094820 0 Left 982094811 4:151912133-151912155 CCATTACCCTGAGTGACCCATCC No data
Right 982094820 4:151912156-151912178 CTGAGAGACCAAGAGGCAGTGGG No data
982094809_982094820 13 Left 982094809 4:151912120-151912142 CCCTGAGGCTGAGCCATTACCCT No data
Right 982094820 4:151912156-151912178 CTGAGAGACCAAGAGGCAGTGGG No data
982094812_982094820 -6 Left 982094812 4:151912139-151912161 CCCTGAGTGACCCATCCCTGAGA No data
Right 982094820 4:151912156-151912178 CTGAGAGACCAAGAGGCAGTGGG No data
982094810_982094820 12 Left 982094810 4:151912121-151912143 CCTGAGGCTGAGCCATTACCCTG No data
Right 982094820 4:151912156-151912178 CTGAGAGACCAAGAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982094820 Original CRISPR CTGAGAGACCAAGAGGCAGT GGG Intergenic
No off target data available for this crispr