ID: 982095222

View in Genome Browser
Species Human (GRCh38)
Location 4:151916047-151916069
Sequence CATGGCCCCCCTGAAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982095222_982095226 10 Left 982095222 4:151916047-151916069 CCAGCTGCTTCAGGGGGGCCATG No data
Right 982095226 4:151916080-151916102 CTGATTGTCCGGGAGCACCCTGG No data
982095222_982095229 27 Left 982095222 4:151916047-151916069 CCAGCTGCTTCAGGGGGGCCATG No data
Right 982095229 4:151916097-151916119 CCCTGGTTGTACCTGCAATGAGG No data
982095222_982095224 -1 Left 982095222 4:151916047-151916069 CCAGCTGCTTCAGGGGGGCCATG No data
Right 982095224 4:151916069-151916091 GCTGAATAGCACTGATTGTCCGG No data
982095222_982095225 0 Left 982095222 4:151916047-151916069 CCAGCTGCTTCAGGGGGGCCATG No data
Right 982095225 4:151916070-151916092 CTGAATAGCACTGATTGTCCGGG No data
982095222_982095231 28 Left 982095222 4:151916047-151916069 CCAGCTGCTTCAGGGGGGCCATG No data
Right 982095231 4:151916098-151916120 CCTGGTTGTACCTGCAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982095222 Original CRISPR CATGGCCCCCCTGAAGCAGC TGG (reversed) Intergenic
No off target data available for this crispr