ID: 982095223

View in Genome Browser
Species Human (GRCh38)
Location 4:151916065-151916087
Sequence ACAATCAGTGCTATTCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982095223_982095226 -8 Left 982095223 4:151916065-151916087 CCATGCTGAATAGCACTGATTGT No data
Right 982095226 4:151916080-151916102 CTGATTGTCCGGGAGCACCCTGG No data
982095223_982095234 26 Left 982095223 4:151916065-151916087 CCATGCTGAATAGCACTGATTGT No data
Right 982095234 4:151916114-151916136 ATGAGGGTGTTTTCTGTCGAGGG No data
982095223_982095229 9 Left 982095223 4:151916065-151916087 CCATGCTGAATAGCACTGATTGT No data
Right 982095229 4:151916097-151916119 CCCTGGTTGTACCTGCAATGAGG No data
982095223_982095233 25 Left 982095223 4:151916065-151916087 CCATGCTGAATAGCACTGATTGT No data
Right 982095233 4:151916113-151916135 AATGAGGGTGTTTTCTGTCGAGG No data
982095223_982095236 30 Left 982095223 4:151916065-151916087 CCATGCTGAATAGCACTGATTGT No data
Right 982095236 4:151916118-151916140 GGGTGTTTTCTGTCGAGGGGTGG No data
982095223_982095231 10 Left 982095223 4:151916065-151916087 CCATGCTGAATAGCACTGATTGT No data
Right 982095231 4:151916098-151916120 CCTGGTTGTACCTGCAATGAGGG No data
982095223_982095235 27 Left 982095223 4:151916065-151916087 CCATGCTGAATAGCACTGATTGT No data
Right 982095235 4:151916115-151916137 TGAGGGTGTTTTCTGTCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982095223 Original CRISPR ACAATCAGTGCTATTCAGCA TGG (reversed) Intergenic
No off target data available for this crispr