ID: 982095224

View in Genome Browser
Species Human (GRCh38)
Location 4:151916069-151916091
Sequence GCTGAATAGCACTGATTGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982095222_982095224 -1 Left 982095222 4:151916047-151916069 CCAGCTGCTTCAGGGGGGCCATG No data
Right 982095224 4:151916069-151916091 GCTGAATAGCACTGATTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982095224 Original CRISPR GCTGAATAGCACTGATTGTC CGG Intergenic
No off target data available for this crispr