ID: 982095225

View in Genome Browser
Species Human (GRCh38)
Location 4:151916070-151916092
Sequence CTGAATAGCACTGATTGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982095222_982095225 0 Left 982095222 4:151916047-151916069 CCAGCTGCTTCAGGGGGGCCATG No data
Right 982095225 4:151916070-151916092 CTGAATAGCACTGATTGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982095225 Original CRISPR CTGAATAGCACTGATTGTCC GGG Intergenic
No off target data available for this crispr