ID: 982095226

View in Genome Browser
Species Human (GRCh38)
Location 4:151916080-151916102
Sequence CTGATTGTCCGGGAGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982095223_982095226 -8 Left 982095223 4:151916065-151916087 CCATGCTGAATAGCACTGATTGT No data
Right 982095226 4:151916080-151916102 CTGATTGTCCGGGAGCACCCTGG No data
982095222_982095226 10 Left 982095222 4:151916047-151916069 CCAGCTGCTTCAGGGGGGCCATG No data
Right 982095226 4:151916080-151916102 CTGATTGTCCGGGAGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982095226 Original CRISPR CTGATTGTCCGGGAGCACCC TGG Intergenic
No off target data available for this crispr