ID: 982095229

View in Genome Browser
Species Human (GRCh38)
Location 4:151916097-151916119
Sequence CCCTGGTTGTACCTGCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982095222_982095229 27 Left 982095222 4:151916047-151916069 CCAGCTGCTTCAGGGGGGCCATG No data
Right 982095229 4:151916097-151916119 CCCTGGTTGTACCTGCAATGAGG No data
982095223_982095229 9 Left 982095223 4:151916065-151916087 CCATGCTGAATAGCACTGATTGT No data
Right 982095229 4:151916097-151916119 CCCTGGTTGTACCTGCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982095229 Original CRISPR CCCTGGTTGTACCTGCAATG AGG Intergenic
No off target data available for this crispr