ID: 982096791

View in Genome Browser
Species Human (GRCh38)
Location 4:151930653-151930675
Sequence TCCCCAGTGCTGCCTGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982096789_982096791 -8 Left 982096789 4:151930638-151930660 CCCAGGGAAGAGCTGTCCCCAGT No data
Right 982096791 4:151930653-151930675 TCCCCAGTGCTGCCTGTGACAGG No data
982096788_982096791 -7 Left 982096788 4:151930637-151930659 CCCCAGGGAAGAGCTGTCCCCAG No data
Right 982096791 4:151930653-151930675 TCCCCAGTGCTGCCTGTGACAGG No data
982096782_982096791 27 Left 982096782 4:151930603-151930625 CCTCTGTGATCATTGGCAAGGGC No data
Right 982096791 4:151930653-151930675 TCCCCAGTGCTGCCTGTGACAGG No data
982096790_982096791 -9 Left 982096790 4:151930639-151930661 CCAGGGAAGAGCTGTCCCCAGTG No data
Right 982096791 4:151930653-151930675 TCCCCAGTGCTGCCTGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982096791 Original CRISPR TCCCCAGTGCTGCCTGTGAC AGG Intergenic
No off target data available for this crispr