ID: 982096873

View in Genome Browser
Species Human (GRCh38)
Location 4:151931337-151931359
Sequence CAGTAGTTCTGGGGCAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982096868_982096873 -6 Left 982096868 4:151931320-151931342 CCCTGGAGATTCTGATTCAGTAG No data
Right 982096873 4:151931337-151931359 CAGTAGTTCTGGGGCAGCCATGG No data
982096867_982096873 -5 Left 982096867 4:151931319-151931341 CCCCTGGAGATTCTGATTCAGTA No data
Right 982096873 4:151931337-151931359 CAGTAGTTCTGGGGCAGCCATGG No data
982096869_982096873 -7 Left 982096869 4:151931321-151931343 CCTGGAGATTCTGATTCAGTAGT No data
Right 982096873 4:151931337-151931359 CAGTAGTTCTGGGGCAGCCATGG No data
982096866_982096873 -2 Left 982096866 4:151931316-151931338 CCACCCCTGGAGATTCTGATTCA No data
Right 982096873 4:151931337-151931359 CAGTAGTTCTGGGGCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982096873 Original CRISPR CAGTAGTTCTGGGGCAGCCA TGG Intergenic
No off target data available for this crispr