ID: 982097453

View in Genome Browser
Species Human (GRCh38)
Location 4:151935785-151935807
Sequence AGGGTTTTGTAGATGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982097443_982097453 22 Left 982097443 4:151935740-151935762 CCAAACACCTAAATGAATTTCTG No data
Right 982097453 4:151935785-151935807 AGGGTTTTGTAGATGGAGAAGGG No data
982097446_982097453 15 Left 982097446 4:151935747-151935769 CCTAAATGAATTTCTGGGAAAAA No data
Right 982097453 4:151935785-151935807 AGGGTTTTGTAGATGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982097453 Original CRISPR AGGGTTTTGTAGATGGAGAA GGG Intergenic
No off target data available for this crispr